17-63939367-CACACATATAT-CACACATATATACACATATATACACATATAT

Variant names:

• chr17-63939367-C-CACACATATATACACATATAT
• NM_000334.4:c.*1384_*1403dupATATATGTGTATATATGTGT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_000334.4(SCN4A):​c.*1384_*1403dupATATATGTGTATATATGTGT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 0)
• Consequence: SCN4A NM_000334.4 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.130

Genes affected

SCN4A (HGNC:10591): (sodium voltage-gated channel alpha subunit 4) Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SCN4A	NM_000334.4	c.*1384_*1403dupATATATGTGTATATATGTGT		3_prime_UTR_variant	Exon 24 of 24	ENST00000435607.3	NP_000325.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SCN4A	ENST00000435607	c.*1384_*1403dupATATATGTGTATATATGTGT		3_prime_UTR_variant	Exon 24 of 24	1	NM_000334.4	ENSP00000396320.1

Frequencies

GnomAD3 genomes AF: 0.00000661 AC: 1 AN: 151356 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000196

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.00000660 AC: 1 AN: 151472 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 73942

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000197

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-62016727;