17-63939367-CACACATATAT-CACACATATATACACATATATACACATATAT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000334.4(SCN4A):c.*1384_*1403dupATATATGTGTATATATGTGT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000334.4 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- hyperkalemic periodic paralysisInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet, G2P
- paramyotonia congenita of Von EulenburgInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Laboratory for Molecular Medicine, G2P, Orphanet, Labcorp Genetics (formerly Invitae)
- SCN4A-related myopathy, autosomal recessiveInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Illumina, ClinGen
- hypokalemic periodic paralysis, type 2Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- potassium-aggravated myotoniaInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- congenital myasthenic syndrome 16Inheritance: AR Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- congenital myopathyInheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
- congenital myopathy 22A, classicInheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- acetazolamide-responsive myotoniaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hypokalemic periodic paralysisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- myotonia fluctuansInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- myotonia permanensInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- postsynaptic congenital myasthenic syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000334.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.00000661 AC: 1AN: 151356Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Cov.: 0
GnomAD4 genome AF: 0.00000660 AC: 1AN: 151472Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 73942 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.