17-7674221-GGTTCATGCCGCCCATGCAGGAACT-G

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3

The NM_000546.6(TP53):​c.718_741delAGTTCCTGCATGGGCGGCATGAAC​(p.Ser240_Asn247del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S240S) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 30)

Consequence

TP53
NM_000546.6 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.32

Publications

7 publications found
Variant links:
Genes affected
TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]
TP53 Gene-Disease associations (from GenCC):
  • breast cancer
    Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
  • Li-Fraumeni syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet
  • Li-Fraumeni syndrome 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
  • adrenocortical carcinoma, hereditary
    Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
  • sarcoma
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • bone marrow failure syndrome 5
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • colorectal cancer
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • choroid plexus carcinoma
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM1
In a hotspot region, there are 72 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 22 uncertain in NM_000546.6
PM4
Nonframeshift variant in NON repetitive region in NM_000546.6.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TP53NM_000546.6 linkc.718_741delAGTTCCTGCATGGGCGGCATGAAC p.Ser240_Asn247del conservative_inframe_deletion Exon 7 of 11 ENST00000269305.9 NP_000537.3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TP53ENST00000269305.9 linkc.718_741delAGTTCCTGCATGGGCGGCATGAAC p.Ser240_Asn247del conservative_inframe_deletion Exon 7 of 11 1 NM_000546.6 ENSP00000269305.4

Frequencies

GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
30

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Feb 23, 2011
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant classified as Uncertain Significance - Favor Pathogenic. The Ser240_Asn2 47del variant has not been previously reported in the literature or been previou sly identified by our laboratory. This variant results in the deletion of eight amino acids. This deletion occurs in a highly conserved region of exon 7, where other pathogenic variants have been observed. However, without additional data, we cannot determine conclusively the effect this deletion will have on the norm al function of TP53. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397516437; hg19: chr17-7577539; API