17-78131566-AGCCTCTACCCGTGCCCGCCGAGATGCT-A

Position:

• chr17-78131566-AGCCTCTACCCGTGCCCGCCGAGATGCT-A

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_152468.5(TMC8):​c.-20_7delCTCTACCCGTGCCCGCCGAGATGCTGC​(p.Met1_Leu3del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000864 in 1,388,910 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000086 (0 hom.)
• Consequence: TMC8 NM_152468.5 start_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.14

Genes affected

TMC8 (HGNC:20474): (transmembrane channel like 8) Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]

TMC6 (HGNC:18021): (transmembrane channel like 6) Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TMC8	NM_152468.5	c.-20_7delCTCTACCCGTGCCCGCCGAGATGCTGC	p.Met1_Leu3del	start_lost, conservative_inframe_deletion	2/16	ENST00000318430.10	NP_689681.2
TMC8	NM_152468.5	c.-20_7delCTCTACCCGTGCCCGCCGAGATGCTGC		5_prime_UTR_variant	2/16	ENST00000318430.10	NP_689681.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TMC8	ENST00000318430.10	c.-20_7delCTCTACCCGTGCCCGCCGAGATGCTGC	p.Met1_Leu3del	start_lost, conservative_inframe_deletion	2/16	1	NM_152468.5	ENSP00000325561.4
TMC8	ENST00000318430	c.-20_7delCTCTACCCGTGCCCGCCGAGATGCTGC		5_prime_UTR_variant	2/16	1	NM_152468.5	ENSP00000325561.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000864 AC: 12 AN: 1388910 Hom.: 0 AF XY: 0.00000584 AC XY: 4 AN XY: 685342

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000111

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.0000113

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Epidermodysplasia verruciformis Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 13, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with TMC8-related conditions. This variant is present in population databases (no rsID available, gnomAD 0.002%). This sequence change affects the initiator methionine of the TMC8 mRNA. The next in-frame methionine is located at codon 26. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1230051290; hg19: chr17-76127647;