17-8003098-C-CGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP5

The NM_000180.4(GUCY2D):​c.52_99dupGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG​(p.Gly18_Leu33dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P34P) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

GUCY2D
NM_000180.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Likely pathogenic no assertion criteria provided P:1O:1

Conservation

PhyloP100: -0.513

Publications

0 publications found
Variant links:
Genes affected
GUCY2D (HGNC:4689): (guanylate cyclase 2D, retinal) This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
GUCY2D Gene-Disease associations (from GenCC):
  • cone-rod dystrophy
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
  • GUCY2D-related dominant retinopathy
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • GUCY2D-related recessive retinopathy
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • Leber congenital amaurosis 1
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • cone-rod dystrophy 6
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • night blindness, congenital stationary, type1i
    Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • Leber congenital amaurosis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • central areolar choroidal dystrophy
    Inheritance: AR, AD Classification: SUPPORTIVE, LIMITED Submitted by: G2P, Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_000180.4.
PP5
Variant 17-8003098-C-CGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG is Pathogenic according to our data. Variant chr17-8003098-C-CGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 98605.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
GUCY2DNM_000180.4 linkc.52_99dupGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG p.Gly18_Leu33dup conservative_inframe_insertion Exon 2 of 20 ENST00000254854.5 NP_000171.1 Q02846
GUCY2DXM_011523816.2 linkc.52_99dupGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG p.Gly18_Leu33dup conservative_inframe_insertion Exon 1 of 19 XP_011522118.1 Q02846

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
GUCY2DENST00000254854.5 linkc.52_99dupGGTCCCGCGTGGTGGGCTCCGTCCCTGCCCCGCCTCCCCCGGGCCCTG p.Gly18_Leu33dup conservative_inframe_insertion Exon 2 of 20 1 NM_000180.4 ENSP00000254854.4 Q02846

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1Other:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Leber congenital amaurosis 1 Pathogenic:1
-
Laboratory of Genetics in Ophthalmology, Institut Imagine
Significance:Likely pathogenic
Review Status:no assertion criteria provided
Collection Method:research

- -

not provided Other:1
-
Retina International
Significance:not provided
Review Status:no classification provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
-0.51
Mutation Taster
=79/21
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs63749076; hg19: chr17-7906416; API