17-9022738-C-CCGAGAACTACCTGCAGTTCCCGCACAA

Variant names:

• chr17-9022738-C-CCGAGAACTACCTGCAGTTCCCGCACAA
• NM_004822.3:c.368_394dupAGAACTACCTGCAGTTCCCGCACAACG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004822.3(NTN1):​c.368_394dupAGAACTACCTGCAGTTCCCGCACAACG​(p.Glu123_Asn131dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: NTN1 NM_004822.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: -3.69
• Publications: 0 publications found

Genes affected

NTN1 (HGNC:8029): (netrin 1) Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]

NTN1 Gene-Disease associations (from GenCC):

• mirror movements 4

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• familial congenital mirror movements

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• multiple congenital anomalies/dysmorphic syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004822.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NTN1	NM_004822.3	c.368_394dupAGAACTACCTGCAGTTCCCGCACAACG	p.Glu123_Asn131dup	disruptive_inframe_insertion	Exon 2 of 7	ENST00000173229.7	NP_004813.2
NTN1	XM_006721595.4	c.368_394dupAGAACTACCTGCAGTTCCCGCACAACG	p.Glu123_Asn131dup	disruptive_inframe_insertion	Exon 2 of 7		XP_006721658.1
NTN1	XM_047437096.1	c.368_394dupAGAACTACCTGCAGTTCCCGCACAACG	p.Glu123_Asn131dup	disruptive_inframe_insertion	Exon 2 of 7		XP_047293052.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NTN1	ENST00000173229.7	c.368_394dupAGAACTACCTGCAGTTCCCGCACAACG	p.Glu123_Asn131dup	disruptive_inframe_insertion	Exon 2 of 7	1	NM_004822.3	ENSP00000173229.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

NTN1-related disorder Uncertain:1

May 14, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The NTN1 c.368_394dup27 variant is predicted to result in an in-frame duplication (p.Glu123_Asn131dup). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-3.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr17-8926055;