18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGC

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.72+841_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.72+841_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000523 in 708,132 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene TCF4 is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.00025 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0000052 (0 hom.)
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885
• Publications: 0 publications found

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

TCF4 Gene-Disease associations (from GenCC):

• Pitt-Hopkins syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, G2P, ClinGen, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• corneal dystrophy, Fuchs endothelial, 3

  Inheritance: AD Classification: STRONG Submitted by: G2P
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fuchs' endothelial dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Specifications for TCF4 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.000251 (34/135538) while in subpopulation NFE AF = 0.000359 (22/61270). AF 95% confidence interval is 0.000242. There are 0 homozygotes in GnomAd4. There are 18 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 34 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	NM_001083962.2	MANE Select	c.72+841_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001077431.1	P15884-3
	TCF4	NM_001243226.3		c.378+841_379-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230155.2	E9PH57
	TCF4	NM_001243228.2		c.72+841_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230157.1	H3BTP3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	ENST00000354452.8	TSL:5 MANE Select	c.72+841_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000346440.3	P15884-3
	TCF4	ENST00000398339.5	TSL:1	c.378+841_379-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000381382.1	E9PH57
	TCF4	ENST00000356073.8	TSL:1	c.72+841_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000348374.4	P15884-1

Frequencies

GnomAD3 genomes AF: 0.000251 AC: 34 AN: 135446 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000186

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000309

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000228

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000359

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000524 AC: 3 AN: 572594 Hom.: 0 AF XY: 0.00000669 AC XY: 2 AN XY: 299148

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 18026

American (AMR) AF: 0.0000454 AC: 1 AN: 22006

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14912

East Asian (EAS) AF: 0.00 AC: 0 AN: 24090

South Asian (SAS) AF: 0.00 AC: 0 AN: 53224

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 23366

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2436

European-Non Finnish (NFE) AF: 0.00000517 AC: 2 AN: 386768

Other (OTH) AF: 0.00 AC: 0 AN: 27766

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000359607), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000251 AC: 34 AN: 135538 Hom.: 0 Cov.: 0 AF XY: 0.000275 AC XY: 18 AN XY: 65550

African (AFR) AF: 0.000186 AC: 7 AN: 37658

American (AMR) AF: 0.000309 AC: 4 AN: 12942

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3176

East Asian (EAS) AF: 0.000228 AC: 1 AN: 4382

South Asian (SAS) AF: 0.00 AC: 0 AN: 3988

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9126

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.000359 AC: 22 AN: 61270

Other (OTH) AF: 0.00 AC: 0 AN: 1876

Alfa AF: 0.00 Hom.: 287

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.89
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs55725917;

hg19: chr18-53253384;