18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGC
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1BS2
The NM_001083962.2(TCF4):c.73-846_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000763 in 708,116 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001083962.2 intron
Scores
Clinical Significance
Conservation
Publications
- Pitt-Hopkins syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, PanelApp Australia, Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
- corneal dystrophy, Fuchs endothelial, 3Inheritance: AD Classification: STRONG Submitted by: G2P
- autosomal dominant non-syndromic intellectual disabilityInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fuchs' endothelial dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autism spectrum disorderInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- intellectual disabilityInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TCF4 | MANE Select | c.73-846_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | NP_001077431.1 | P15884-3 | |||
| TCF4 | c.379-846_379-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | NP_001230155.2 | E9PH57 | ||||
| TCF4 | c.73-846_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | NP_001230157.1 | H3BTP3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TCF4 | TSL:5 MANE Select | c.73-846_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | ENSP00000346440.3 | P15884-3 | |||
| TCF4 | TSL:1 | c.379-846_379-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | ENSP00000381382.1 | E9PH57 | |||
| TCF4 | TSL:1 | c.73-846_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | ENSP00000348374.4 | P15884-1 |
Frequencies
GnomAD3 genomes AF: 0.000310 AC: 42AN: 135444Hom.: 1 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000210 AC: 12AN: 572580Hom.: 0 AF XY: 0.0000334 AC XY: 10AN XY: 299134 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000310 AC: 42AN: 135536Hom.: 1 Cov.: 0 AF XY: 0.000214 AC XY: 14AN XY: 65546 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at