18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-831_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_001083962.2(TCF4):​c.73-831_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0766 in 566,876 control chromosomes in the GnomAD database, including 4,253 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.14 (1331 hom., cov: 0)
  • Exomes 𝑓: 0.077 (4253 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAdExome4 highest subpopulation (MID) allele frequency at 95% confidence interval = 0.0796 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-831_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-831_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.138 AC: 18619 AN: 135268 Hom.: 1328 Cov.: 0

Gnomad AFR AF: 0.144

Gnomad AMI AF: 0.0897

Gnomad AMR AF: 0.102

Gnomad ASJ AF: 0.116

Gnomad EAS AF: 0.0223

Gnomad SAS AF: 0.0602

Gnomad FIN AF: 0.154

Gnomad MID AF: 0.115

Gnomad NFE AF: 0.154

Gnomad OTH AF: 0.134

GnomAD4 exome AF: 0.0766 AC: 43403 AN: 566876 Hom.: 4253 AF XY: 0.0767 AC XY: 22731 AN XY: 296180

Gnomad4 AFR exome AF: 0.0753

Gnomad4 AMR exome AF: 0.0531

Gnomad4 ASJ exome AF: 0.0712

Gnomad4 EAS exome AF: 0.0136

Gnomad4 SAS exome AF: 0.0452

Gnomad4 FIN exome AF: 0.161

Gnomad4 NFE exome AF: 0.0803

Gnomad4 OTH exome AF: 0.0910

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.138 AC: 18629 AN: 135360 Hom.: 1331 Cov.: 0 AF XY: 0.133 AC XY: 8733 AN XY: 65454

Gnomad4 AFR AF: 0.144

Gnomad4 AMR AF: 0.102

Gnomad4 ASJ AF: 0.116

Gnomad4 EAS AF: 0.0228

Gnomad4 SAS AF: 0.0615

Gnomad4 FIN AF: 0.154

Gnomad4 NFE AF: 0.154

Gnomad4 OTH AF: 0.133

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;