18-657645-A-ACCGCGCCACTTGGCCTGCCTCCGTCCCG

Variant names:

• chr18-657645-A-ACCGCGCCACTTGGCCTGCCTCCGTCCCG
• rs45445694
• ENST00000323274.15:c.-58_-31dupGGCCTGCCTCCGTCCCGCCGCGCCACTT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The ENST00000323274.15(TYMS):​c.-58_-31dupGGCCTGCCTCCGTCCCGCCGCGCCACTT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0078 (39 hom., cov: 0)
  • Exomes 𝑓: 0.00047 (3 hom.)
• Consequence: TYMS ENST00000323274.15 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.618
• Publications: 51 publications found

Genes affected

TYMS (HGNC:12441): (thymidylate synthetase) Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy. [provided by RefSeq, Aug 2017]

TYMSOS (HGNC:29553): (TYMS opposite strand RNA)

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.00776 (1151/148296) while in subpopulation AFR AF = 0.0264 (1053/39892). AF 95% confidence interval is 0.0251. There are 39 homozygotes in GnomAd4. There are 507 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 39 Digenic gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000323274.15. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TYMSOS	NR_171001.1		n.450+169_450+196dupCGGGACGGAGGCAGGCCAAGTGGCGCGG		intron	N/A
	TYMS	NM_001071.4	MANE Select	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene	N/A	NP_001062.1	Q53Y97
	TYMS	NM_001354867.2		c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene	N/A	NP_001341796.1	P04818-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TYMS	ENST00000323274.15	TSL:1 MANE Select	c.-58_-31dupGGCCTGCCTCCGTCCCGCCGCGCCACTT		5_prime_UTR	Exon 1 of 7	ENSP00000315644.10	P04818-1
	TYMSOS	ENST00000323813.6	TSL:1	n.511+169_511+196dupCGGGACGGAGGCAGGCCAAGTGGCGCGG		intron	N/A
	TYMS	ENST00000918013.1		c.-58_-31dupGGCCTGCCTCCGTCCCGCCGCGCCACTT		5_prime_UTR	Exon 1 of 7	ENSP00000588072.1

Frequencies

GnomAD3 genomes AF: 0.00777 AC: 1152 AN: 148190 Hom.: 40 Cov.: 0

Gnomad AFR AF: 0.0265

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00280

Gnomad ASJ AF: 0.00116

Gnomad EAS AF: 0.000797

Gnomad SAS AF: 0.00149

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000449

Gnomad OTH AF: 0.00592

GnomAD4 exome AF: 0.000472 AC: 403 AN: 854572 Hom.: 3 Cov.: 4 AF XY: 0.000478 AC XY: 201 AN XY: 420306

African (AFR) AF: 0.0107 AC: 173 AN: 16226

American (AMR) AF: 0.00267 AC: 20 AN: 7494

Ashkenazi Jewish (ASJ) AF: 0.00162 AC: 21 AN: 12938

East Asian (EAS) AF: 0.000724 AC: 16 AN: 22104

South Asian (SAS) AF: 0.000855 AC: 24 AN: 28070

European-Finnish (FIN) AF: 0.000201 AC: 5 AN: 24826

Middle Eastern (MID) AF: 0.000790 AC: 2 AN: 2532

European-Non Finnish (NFE) AF: 0.000132 AC: 93 AN: 704788

Other (OTH) AF: 0.00138 AC: 49 AN: 35594

GnomAD4 genome AF: 0.00776 AC: 1151 AN: 148296 Hom.: 39 Cov.: 0 AF XY: 0.00700 AC XY: 507 AN XY: 72388

African (AFR) AF: 0.0264 AC: 1053 AN: 39892

American (AMR) AF: 0.00280 AC: 42 AN: 15012

Ashkenazi Jewish (ASJ) AF: 0.00116 AC: 4 AN: 3444

East Asian (EAS) AF: 0.000800 AC: 4 AN: 5002

South Asian (SAS) AF: 0.00128 AC: 6 AN: 4704

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10252

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 288

European-Non Finnish (NFE) AF: 0.000449 AC: 30 AN: 66760

Other (OTH) AF: 0.00585 AC: 12 AN: 2050

Alfa AF: 0.000105 Hom.: 531

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.62
Mutation Taster		=300/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs45445694; hg19: chr18-657645;