18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG

Variant names:

• chr18-657645-A-ACCGCGCCACTTGGCCTGCCTCCGTCCCG
• rs45445694
• ENST00000323813.5:n.509+196_509+197insCGGGACGGAGGCAGGCCAAGTGGCGCGG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The ENST00000323813.5(TYMSOS):​n.509+196_509+197insCGGGACGGAGGCAGGCCAAGTGGCGCGG variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0078 (39 hom., cov: 0)
  • Exomes 𝑓: 0.00047 (3 hom.)
• Consequence: TYMSOS ENST00000323813.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.618

Genes affected

TYMSOS (HGNC:29553): (TYMS opposite strand RNA)

TYMS (HGNC:12441): (thymidylate synthetase) Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy. [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00776 (1151/148296) while in subpopulation AFR AF= 0.0264 (1053/39892). AF 95% confidence interval is 0.0251. There are 39 homozygotes in gnomad4. There are 507 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 39 gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TYMSOS	NR_171001.1	n.450+169_450+196dupCGGGACGGAGGCAGGCCAAGTGGCGCGG		intron_variant	Intron 1 of 1
TYMS	NM_001071.4	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		ENST00000323274.15	NP_001062.1
TYMS	NM_001354867.2	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant			NP_001341796.1
TYMS	NM_001354868.2	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant			NP_001341797.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TYMS	ENST00000323274.15	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		1	NM_001071.4	ENSP00000315644.10

Frequencies

GnomAD3 genomes AF: 0.00777 AC: 1152 AN: 148190 Hom.: 40 Cov.: 0

Gnomad AFR AF: 0.0265

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00280

Gnomad ASJ AF: 0.00116

Gnomad EAS AF: 0.000797

Gnomad SAS AF: 0.00149

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000449

Gnomad OTH AF: 0.00592

GnomAD4 exome AF: 0.000472 AC: 403 AN: 854572 Hom.: 3 Cov.: 4 AF XY: 0.000478 AC XY: 201 AN XY: 420306

Gnomad4 AFR exome AF: 0.0107

Gnomad4 AMR exome AF: 0.00267

Gnomad4 ASJ exome AF: 0.00162

Gnomad4 EAS exome AF: 0.000724

Gnomad4 SAS exome AF: 0.000855

Gnomad4 FIN exome AF: 0.000201

Gnomad4 NFE exome AF: 0.000132

Gnomad4 OTH exome AF: 0.00138

GnomAD4 genome AF: 0.00776 AC: 1151 AN: 148296 Hom.: 39 Cov.: 0 AF XY: 0.00700 AC XY: 507 AN XY: 72388

Gnomad4 AFR AF: 0.0264

Gnomad4 AMR AF: 0.00280

Gnomad4 ASJ AF: 0.00116

Gnomad4 EAS AF: 0.000800

Gnomad4 SAS AF: 0.00128

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000449

Gnomad4 OTH AF: 0.00585

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs45445694; hg19: chr18-657645;