18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG

Position:

• chr18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NR_171001.1(TYMSOS):​n.450+141_450+196dupCGGGACGGAGGCAGGCCAAGTGGCGCGGCGGGACGGAGGCAGGCCAAGTGGCGCGG variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000013 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TYMSOS NR_171001.1 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.618

Genes affected

TYMSOS (HGNC:):

TYMS (HGNC:12441): (thymidylate synthetase) Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy. [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TYMSOS	NR_171001.1	n.450+141_450+196dupCGGGACGGAGGCAGGCCAAGTGGCGCGGCGGGACGGAGGCAGGCCAAGTGGCGCGG		intron_variant
TYMS	NM_001071.4	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		ENST00000323274.15	NP_001062.1
TYMS	NM_001354867.2	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant			NP_001341796.1
TYMS	NM_001354868.2	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant			NP_001341797.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TYMS	ENST00000323274.15	c.-98_-97insCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		1	NM_001071.4	ENSP00000315644.10

Frequencies

GnomAD3 genomes AF: 0.0000135 AC: 2 AN: 148234 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000251

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000199

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000129 AC: 11 AN: 854606 Hom.: 0 Cov.: 4 AF XY: 0.0000214 AC XY: 9 AN XY: 420324

Gnomad4 AFR exome AF: 0.0000616

Gnomad4 AMR exome AF: 0.000133

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000226

Gnomad4 SAS exome AF: 0.0000356

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000284

Gnomad4 OTH exome AF: 0.0000281

GnomAD4 genome AF: 0.0000135 AC: 2 AN: 148234 Hom.: 0 Cov.: 0 AF XY: 0.0000138 AC XY: 1 AN XY: 72296

Gnomad4 AFR AF: 0.0000251

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000199

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs45445694; hg19: chr18-657645;