19-10718216-GCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAAC-G

Position:

• chr19-10718216-GCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAAC-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_001005361.3(DNM2):​c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000154 in 1,297,224 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000015 (0 hom.)
• Consequence: DNM2 NM_001005361.3 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.16

Genes affected

DNM2 (HGNC:2974): (dynamin 2) Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]

DNM2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 41 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DNM2	NM_001005361.3	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC	p.Met1fs	frameshift_variant, start_lost	1/21	ENST00000389253.9	NP_001005361.1
DNM2	NM_001005361.3	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC		5_prime_UTR_variant	1/21	ENST00000389253.9	NP_001005361.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DNM2	ENST00000389253.9	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC	p.Met1fs	frameshift_variant, start_lost	1/21	5	NM_001005361.3	ENSP00000373905.4
DNM2	ENST00000389253	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC		5_prime_UTR_variant	1/21	5	NM_001005361.3	ENSP00000373905.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000154 AC: 2 AN: 1297224 Hom.: 0 AF XY: 0.00000313 AC XY: 2 AN XY: 639196

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000194

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Charcot-Marie-Tooth disease dominant intermediate B Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 13, 2023

This sequence change affects the initiator methionine of the DNM2 mRNA. The next in-frame methionine is located at codon 6. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DNM2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-10828892;