19-10718216-GCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAAC-G

Variant names:

• chr19-10718216-GCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAAC-G
• NM_001005361.3:c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_001005361.3(DNM2):​c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000154 in 1,297,224 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000015 (0 hom.)
• Consequence: DNM2 NM_001005361.3 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.16
• Publications: 0 publications found

Genes affected

DNM2 (HGNC:2974): (dynamin 2) Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]

MIR638 (HGNC:32894): (microRNA 638) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 37 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DNM2	NM_001005361.3	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 21	ENST00000389253.9	NP_001005361.1
DNM2	NM_001005361.3	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC		5_prime_UTR_variant	Exon 1 of 21	ENST00000389253.9	NP_001005361.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DNM2	ENST00000389253.9	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 21	5	NM_001005361.3	ENSP00000373905.4
DNM2	ENST00000389253.9	c.-23_12delTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGC		5_prime_UTR_variant	Exon 1 of 21	5	NM_001005361.3	ENSP00000373905.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000154 AC: 2 AN: 1297224 Hom.: 0 AF XY: 0.00000313 AC XY: 2 AN XY: 639196

African (AFR) AF: 0.00 AC: 0 AN: 26148

American (AMR) AF: 0.00 AC: 0 AN: 24612

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22116

East Asian (EAS) AF: 0.00 AC: 0 AN: 27108

South Asian (SAS) AF: 0.00 AC: 0 AN: 69022

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 41710

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3764

European-Non Finnish (NFE) AF: 0.00000194 AC: 2 AN: 1029836

Other (OTH) AF: 0.00 AC: 0 AN: 52908

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Charcot-Marie-Tooth disease dominant intermediate B Uncertain:1

Oct 22, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the DNM2 mRNA. The next in-frame methionine is located at codon 6. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DNM2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr19-10828892;