19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-C

Position:

• chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-C

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001127222.2(CACNA1A):​c.6946_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln2316_Gln2325del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000349 in 1,431,740 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000068 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0000031 (0 hom.)
• Consequence: CACNA1A NM_001127222.2 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.785

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CACNA1A	NM_001127222.2	c.6946_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2316_Gln2325del	conservative_inframe_deletion	47/47	ENST00000360228.11	NP_001120694.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CACNA1A	ENST00000360228.11	c.6946_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2316_Gln2325del	conservative_inframe_deletion	47/47	1	NM_001127222.2	ENSP00000353362.5
CACNA1A	ENST00000638029.1	c.6964_6993delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2322_Gln2331del	conservative_inframe_deletion	48/48	5		ENSP00000489829.1
CACNA1A	ENST00000573710.7	c.6952_6981delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2327del	conservative_inframe_deletion	47/47	5		ENSP00000460092.3
CACNA1A	ENST00000635727.1	c.6949_6978delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2317_Gln2326del	conservative_inframe_deletion	47/47	5		ENSP00000490001.1
CACNA1A	ENST00000637769.1	c.6949_6978delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2317_Gln2326del	conservative_inframe_deletion	47/47	1		ENSP00000489778.1
CACNA1A	ENST00000636012.1	c.6913_6942delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2305_Gln2314del	conservative_inframe_deletion	46/46	5		ENSP00000490223.1
CACNA1A	ENST00000637736.1	c.6808_6837delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2270_Gln2279del	conservative_inframe_deletion	46/46	5		ENSP00000489861.1
CACNA1A	ENST00000636389	c.*32_*61delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	47/47	5		ENSP00000489992.1
CACNA1A	ENST00000637432	c.*158_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	48/48	5		ENSP00000490617.1
CACNA1A	ENST00000635895	c.*158_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	47/47	5		ENSP00000490323.1
CACNA1A	ENST00000638009	c.*158_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	47/47	1		ENSP00000489913.1
CACNA1A	ENST00000637276	c.*158_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	46/46	5		ENSP00000489777.1

Frequencies

GnomAD3 genomes AF: 0.00000677 AC: 1 AN: 147802 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000249

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000312 AC: 4 AN: 1283938 Hom.: 0 AF XY: 0.00000475 AC XY: 3 AN XY: 631946

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000389

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000677 AC: 1 AN: 147802 Hom.: 0 Cov.: 0 AF XY: 0.0000139 AC XY: 1 AN XY: 71886

Gnomad4 AFR AF: 0.0000249

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs16054; hg19: chr19-13318672;