19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Position:

• chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001127222.2(CACNA1A):​c.6955_6975dupCAGCAGCAGCAGCAGCAGCAG​(p.Gln2319_Gln2325dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000068 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000045 (1 hom.)
• Consequence: CACNA1A NM_001127222.2 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.0000677 (10/147802) while in subpopulation EAS AF= 0.00103 (5/4832). AF 95% confidence interval is 0.000408. There are 0 homozygotes in gnomad4. There are 3 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 10 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CACNA1A	NM_001127222.2	c.6955_6975dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2319_Gln2325dup	conservative_inframe_insertion	47/47	ENST00000360228.11	NP_001120694.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CACNA1A	ENST00000360228.11	c.6955_6975dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2319_Gln2325dup	conservative_inframe_insertion	47/47	1	NM_001127222.2	ENSP00000353362.5
CACNA1A	ENST00000638029.1	c.6973_6993dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2325_Gln2331dup	conservative_inframe_insertion	48/48	5		ENSP00000489829.1
CACNA1A	ENST00000573710.7	c.6961_6981dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2321_Gln2327dup	conservative_inframe_insertion	47/47	5		ENSP00000460092.3
CACNA1A	ENST00000635727.1	c.6958_6978dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2320_Gln2326dup	conservative_inframe_insertion	47/47	5		ENSP00000490001.1
CACNA1A	ENST00000637769.1	c.6958_6978dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2320_Gln2326dup	conservative_inframe_insertion	47/47	1		ENSP00000489778.1
CACNA1A	ENST00000636012.1	c.6922_6942dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2308_Gln2314dup	conservative_inframe_insertion	46/46	5		ENSP00000490223.1
CACNA1A	ENST00000637736.1	c.6817_6837dupCAGCAGCAGCAGCAGCAGCAG	p.Gln2273_Gln2279dup	conservative_inframe_insertion	46/46	5		ENSP00000489861.1
CACNA1A	ENST00000636389	c.*41_*61dupCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	47/47	5		ENSP00000489992.1
CACNA1A	ENST00000637432	c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	48/48	5		ENSP00000490617.1
CACNA1A	ENST00000635895	c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	47/47	5		ENSP00000490323.1
CACNA1A	ENST00000638009	c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	47/47	1		ENSP00000489913.1
CACNA1A	ENST00000637276	c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	46/46	5		ENSP00000489777.1

Frequencies

GnomAD3 genomes AF: 0.0000677 AC: 10 AN: 147802 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00103

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000751

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000452 AC: 58 AN: 1283938 Hom.: 1 Cov.: 0 AF XY: 0.0000475 AC XY: 30 AN XY: 631946

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000415

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000811

Gnomad4 SAS exome AF: 0.0000457

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000263

Gnomad4 OTH exome AF: 0.0000564

GnomAD4 genome AF: 0.0000677 AC: 10 AN: 147802 Hom.: 0 Cov.: 0 AF XY: 0.0000417 AC XY: 3 AN XY: 71886

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00103

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000751

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs16054; hg19: chr19-13318672;