19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1BS2
The NM_001127222.2(CACNA1A):c.6955_6975dupCAGCAGCAGCAGCAGCAGCAG(p.Gln2319_Gln2325dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001127222.2 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- episodic ataxia type 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- undetermined early-onset epileptic encephalopathyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
- developmental and epileptic encephalopathy, 42Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- migraine, familial hemiplegic, 1Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- spinocerebellar ataxia type 6Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
- benign paroxysmal torticollis of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial or sporadic hemiplegic migraineInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Lennox-Gastaut syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CACNA1A | ENST00000360228.11 | c.6955_6975dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2319_Gln2325dup | conservative_inframe_insertion | Exon 47 of 47 | 1 | NM_001127222.2 | ENSP00000353362.5 | ||
CACNA1A | ENST00000638029.1 | c.6973_6993dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2325_Gln2331dup | conservative_inframe_insertion | Exon 48 of 48 | 5 | ENSP00000489829.1 | |||
CACNA1A | ENST00000573710.7 | c.6961_6981dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2321_Gln2327dup | conservative_inframe_insertion | Exon 47 of 47 | 5 | ENSP00000460092.3 | |||
CACNA1A | ENST00000635727.1 | c.6958_6978dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2320_Gln2326dup | conservative_inframe_insertion | Exon 47 of 47 | 5 | ENSP00000490001.1 | |||
CACNA1A | ENST00000637769.1 | c.6958_6978dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2320_Gln2326dup | conservative_inframe_insertion | Exon 47 of 47 | 1 | ENSP00000489778.1 | |||
CACNA1A | ENST00000636012.1 | c.6922_6942dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2308_Gln2314dup | conservative_inframe_insertion | Exon 46 of 46 | 5 | ENSP00000490223.1 | |||
CACNA1A | ENST00000637736.1 | c.6817_6837dupCAGCAGCAGCAGCAGCAGCAG | p.Gln2273_Gln2279dup | conservative_inframe_insertion | Exon 46 of 46 | 5 | ENSP00000489861.1 | |||
CACNA1A | ENST00000636768.2 | n.*1216_*1236dupCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon_variant | Exon 45 of 45 | 5 | ENSP00000490190.2 | ||||
CACNA1A | ENST00000713789.1 | n.*2134_*2154dupCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon_variant | Exon 47 of 47 | ENSP00000519091.1 | |||||
CACNA1A | ENST00000636389.1 | c.*41_*61dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | 5 | ENSP00000489992.1 | ||||
CACNA1A | ENST00000637432.1 | c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 48 of 48 | 5 | ENSP00000490617.1 | ||||
CACNA1A | ENST00000635895.1 | c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | 5 | ENSP00000490323.1 | ||||
CACNA1A | ENST00000638009.2 | c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | 1 | ENSP00000489913.1 | ||||
CACNA1A | ENST00000637276.1 | c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 46 of 46 | 5 | ENSP00000489777.1 | ||||
CACNA1A | ENST00000636768.2 | n.*1216_*1236dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 45 of 45 | 5 | ENSP00000490190.2 | ||||
CACNA1A | ENST00000713789.1 | n.*2134_*2154dupCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | ENSP00000519091.1 | |||||
CACNA1A | ENST00000636549.1 | c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG | downstream_gene_variant | 5 | ENSP00000490578.1 | |||||
CACNA1A | ENST00000637927.1 | c.*167_*187dupCAGCAGCAGCAGCAGCAGCAG | downstream_gene_variant | 5 | ENSP00000489715.1 |
Frequencies
GnomAD3 genomes AF: 0.0000677 AC: 10AN: 147802Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000452 AC: 58AN: 1283938Hom.: 1 Cov.: 0 AF XY: 0.0000475 AC XY: 30AN XY: 631946 show subpopulations
GnomAD4 genome AF: 0.0000677 AC: 10AN: 147802Hom.: 0 Cov.: 0 AF XY: 0.0000417 AC XY: 3AN XY: 71886 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at