19-35732782-CTCGGGGCCAGGGCACGCCTCCT-CTCGGGGCCAGGGCACGCCTCCTTCGGGGCCAGGGCACGCCTCCT

Variant names:

• chr19-35732782-C-CTCGGGGCCAGGGCACGCCTCCT
• rs1555732987
• NM_014727.3:c.6245_6266dupGCACGCCTCCTTCGGGGCCAGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_014727.3(KMT2B):​c.6245_6266dupGCACGCCTCCTTCGGGGCCAGG​(p.Val2090HisfsTer25) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KMT2B NM_014727.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: -0.382
• Publications: 1 publications found

Genes affected

KMT2B (HGNC:15840): (lysine methyltransferase 2B) This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]

KMT2B Gene-Disease associations (from GenCC):

• complex neurodevelopmental disorder with motor features

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• dystonia 28, childhood-onset

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet, Genomics England PanelApp
• intellectual developmental disorder, autosomal dominant 68

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-35732782-C-CTCGGGGCCAGGGCACGCCTCCT is Pathogenic according to our data. Variant chr19-35732782-C-CTCGGGGCCAGGGCACGCCTCCT is described in ClinVar as Pathogenic. ClinVar VariationId is 520719.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_014727.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KMT2B	NM_014727.3	MANE Select	c.6245_6266dupGCACGCCTCCTTCGGGGCCAGG	p.Val2090HisfsTer25	frameshift	Exon 28 of 37	NP_055542.1	Q9UMN6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KMT2B	ENST00000420124.4	TSL:1 MANE Select	c.6245_6266dupGCACGCCTCCTTCGGGGCCAGG	p.Val2090HisfsTer25	frameshift	Exon 28 of 37	ENSP00000398837.2	Q9UMN6
	KMT2B	ENST00000673918.2		c.6179_6200dupGCACGCCTCCTTCGGGGCCAGG	p.Val2068HisfsTer25	frameshift	Exon 28 of 37	ENSP00000501283.1	A0A669KBI7
	KMT2B	ENST00000691421.1		c.1466_1487dupGCACGCCTCCTTCGGGGCCAGG	p.Val497HisfsTer25	frameshift	Exon 7 of 8	ENSP00000508674.1	A0A8I5KUL1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Inborn genetic diseases (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.38
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555732987; hg19: chr19-36223683;