19-43543341-CGTGTGTGTGTGTGTGTGTGTGTGTGTGT-CGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_006297.3(XRCC1):c.*50_*51insACACACACACACACACACACACACACACACACACACACAC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_006297.3 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- head and neck cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- spinocerebellar ataxia, autosomal recessive 26Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006297.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| XRCC1 | NM_006297.3 | MANE Select | c.*50_*51insACACACACACACACACACACACACACACACACACACACAC | 3_prime_UTR | Exon 17 of 17 | NP_006288.2 | P18887 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| XRCC1 | ENST00000262887.10 | TSL:1 MANE Select | c.*50_*51insACACACACACACACACACACACACACACACACACACACAC | 3_prime_UTR | Exon 17 of 17 | ENSP00000262887.5 | P18887 | ||
| XRCC1 | ENST00000953258.1 | c.*50_*51insACACACACACACACACACACACACACACACACACACACAC | 3_prime_UTR | Exon 17 of 17 | ENSP00000623317.1 | ||||
| XRCC1 | ENST00000865401.1 | c.*50_*51insACACACACACACACACACACACACACACACACACACACAC | 3_prime_UTR | Exon 17 of 17 | ENSP00000535460.1 |
Frequencies
GnomAD3 genomes AF: 0.000280 AC: 39AN: 139216Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000265 AC: 24AN: 905246Hom.: 0 Cov.: 0 AF XY: 0.0000236 AC XY: 11AN XY: 465796 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000287 AC: 40AN: 139318Hom.: 0 Cov.: 0 AF XY: 0.000267 AC XY: 18AN XY: 67318 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at