19-45940207-CGCCCCCTCCGCCCGCCCCGCCGCCCGCCCCG-C

Position:

• chr19-45940207-CGCCCCCTCCGCCCGCCCCGCCGCCCGCCCCG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_002516.4(NOVA2):​c.1104_1134delCGGGGCGGGCGGCGGGGCGGGCGGAGGGGGC​(p.Gly369fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NOVA2 NM_002516.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.30

Genes affected

NOVA2 (HGNC:7887): (NOVA alternative splicing regulator 2) Enables sequence-specific mRNA binding activity. Involved in neuron differentiation and regulation of alternative mRNA splicing, via spliceosome. Predicted to be active in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.254 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-45940207-CGCCCCCTCCGCCCGCCCCGCCGCCCGCCCCG-C is Pathogenic according to our data. Variant chr19-45940207-CGCCCCCTCCGCCCGCCCCGCCGCCCGCCCCG-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2630361.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NOVA2	NM_002516.4	c.1104_1134delCGGGGCGGGCGGCGGGGCGGGCGGAGGGGGC	p.Gly369fs	frameshift_variant	4/4	ENST00000263257.6	NP_002507.1
NOVA2	XM_006723230.4	c.777_807delCGGGGCGGGCGGCGGGGCGGGCGGAGGGGGC	p.Gly260fs	frameshift_variant	5/5		XP_006723293.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NOVA2	ENST00000263257.6	c.1104_1134delCGGGGCGGGCGGCGGGGCGGGCGGAGGGGGC	p.Gly369fs	frameshift_variant	4/4	1	NM_002516.4	ENSP00000263257.4
NOVA2	ENST00000676183.1	c.1296_1326delCGGGGCGGGCGGCGGGGCGGGCGGAGGGGGC	p.Gly433fs	frameshift_variant	4/4			ENSP00000501708.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

NOVA2-related disorder Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

Mar 03, 2023

The NOVA2 c.1104_1134del31 variant is predicted to result in a frameshift and premature protein termination (p.Gly369Alafs*17). To our knowledge, this variant has not been reported in the literature or in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. However, frameshift variants in NOVA2 are expected to be pathogenic (see, for example, Mattioli et al. 2020. PubMed ID: 32197073; Scala et al. 2022. PubMed ID: 35607920). Taken together, this variant is interpreted as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-46443465;