19-48297065-GGCCTCCGCTCGAATCAGACGCTGT-G

Variant names:

• chr19-48297065-GGCCTCCGCTCGAATCAGACGCTGT-G
• rs776327192
• NM_001364171.2:c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001364171.2(ODAD1):​c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC​(p.Thr671_Gly678del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000254 in 1,612,978 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T671T) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: ODAD1 NM_001364171.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.91
• Publications: 0 publications found

Genes affected

ODAD1 (HGNC:26560): (outer dynein arm docking complex subunit 1) This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]

ODAD1 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 20

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001364171.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ODAD1	NM_001364171.2	c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC	p.Thr671_Gly678del	conservative_inframe_deletion	Exon 16 of 16	ENST00000674294.1	NP_001351100.1
ODAD1	NM_144577.4	c.1900_1923delACAGCGTCTGATTCGAGCGGAGGC	p.Thr634_Gly641del	conservative_inframe_deletion	Exon 14 of 14		NP_653178.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ODAD1	ENST00000674294.1	c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC	p.Thr671_Gly678del	conservative_inframe_deletion	Exon 16 of 16		NM_001364171.2	ENSP00000501363.1

Frequencies

GnomAD3 genomes AF: 0.0000329 AC: 5 AN: 152102 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000196

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000239 AC: 6 AN: 250614 AF XY: 0.0000295

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000529

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000246 AC: 36 AN: 1460876 Hom.: 0 AF XY: 0.0000289 AC XY: 21 AN XY: 726822

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.0000224 AC: 1 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26124

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86246

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52892

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5742

European-Non Finnish (NFE) AF: 0.0000288 AC: 32 AN: 1111626

Other (OTH) AF: 0.0000331 AC: 2 AN: 60364

GnomAD4 genome AF: 0.0000329 AC: 5 AN: 152102 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74292

African (AFR) AF: 0.00 AC: 0 AN: 41426

American (AMR) AF: 0.000196 AC: 3 AN: 15272

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5176

South Asian (SAS) AF: 0.00 AC: 0 AN: 4822

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 68002

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000113

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia Uncertain:1

Mar 08, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant, c.1900_1923del, results in the deletion of 8 amino acid(s) of the CCDC114 protein (p.Thr634_Gly641del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs776327192, gnomAD 0.005%). This variant has not been reported in the literature in individuals affected with CCDC114-related conditions. ClinVar contains an entry for this variant (Variation ID: 2173903). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.9
Mutation Taster		=181/19	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs776327192; hg19: chr19-48800322;