19-48297065-GGCCTCCGCTCGAATCAGACGCTGT-G
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001364171.2(ODAD1):c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC(p.Thr671_Gly678del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000254 in 1,612,978 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001364171.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ODAD1 | NM_001364171.2 | c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC | p.Thr671_Gly678del | conservative_inframe_deletion | Exon 16 of 16 | ENST00000674294.1 | NP_001351100.1 | |
ODAD1 | NM_144577.4 | c.1900_1923delACAGCGTCTGATTCGAGCGGAGGC | p.Thr634_Gly641del | conservative_inframe_deletion | Exon 14 of 14 | NP_653178.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ODAD1 | ENST00000674294.1 | c.2011_2034delACAGCGTCTGATTCGAGCGGAGGC | p.Thr671_Gly678del | conservative_inframe_deletion | Exon 16 of 16 | NM_001364171.2 | ENSP00000501363.1 |
Frequencies
GnomAD3 genomes AF: 0.0000329 AC: 5AN: 152102Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000239 AC: 6AN: 250614Hom.: 0 AF XY: 0.0000295 AC XY: 4AN XY: 135580
GnomAD4 exome AF: 0.0000246 AC: 36AN: 1460876Hom.: 0 AF XY: 0.0000289 AC XY: 21AN XY: 726822
GnomAD4 genome AF: 0.0000329 AC: 5AN: 152102Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3AN XY: 74292
ClinVar
Submissions by phenotype
Primary ciliary dyskinesia Uncertain:1
Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant, c.1900_1923del, results in the deletion of 8 amino acid(s) of the CCDC114 protein (p.Thr634_Gly641del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs776327192, gnomAD 0.005%). This variant has not been reported in the literature in individuals affected with CCDC114-related conditions. ClinVar contains an entry for this variant (Variation ID: 2173903). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at