19-48297065-GGCCTCCGCTCGAATCAGACGCTGT-GGCCTCCGCTCGAATCAGACGCTGTGCCTCCGCTCGAATCAGACGCTGT

Variant names:

• chr19-48297065-G-GGCCTCCGCTCGAATCAGACGCTGT
• rs776327192
• NM_001364171.2:c.2011_2034dupACAGCGTCTGATTCGAGCGGAGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001364171.2(ODAD1):​c.2011_2034dupACAGCGTCTGATTCGAGCGGAGGC​(p.Gly678_Leu679insThrAlaSerAspSerSerGlyGly) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,460,876 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: ODAD1 NM_001364171.2 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.31
• Publications: 0 publications found

Genes affected

ODAD1 (HGNC:26560): (outer dynein arm docking complex subunit 1) This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]

ODAD1 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 20

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001364171.2.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001364171.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ODAD1	NM_001364171.2	MANE Select	c.2011_2034dupACAGCGTCTGATTCGAGCGGAGGC	p.Gly678_Leu679insThrAlaSerAspSerSerGlyGly	conservative_inframe_insertion	Exon 16 of 16	NP_001351100.1	A0A6I8PTZ2
	ODAD1	NM_144577.4		c.1900_1923dupACAGCGTCTGATTCGAGCGGAGGC	p.Gly641_Leu642insThrAlaSerAspSerSerGlyGly	conservative_inframe_insertion	Exon 14 of 14	NP_653178.3	Q96M63-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ODAD1	ENST00000674294.1	MANE Select	c.2011_2034dupACAGCGTCTGATTCGAGCGGAGGC	p.Gly678_Leu679insThrAlaSerAspSerSerGlyGly	conservative_inframe_insertion	Exon 16 of 16	ENSP00000501363.1	A0A6I8PTZ2
	ODAD1	ENST00000315396.7	TSL:1	c.1900_1923dupACAGCGTCTGATTCGAGCGGAGGC	p.Gly641_Leu642insThrAlaSerAspSerSerGlyGly	conservative_inframe_insertion	Exon 14 of 14	ENSP00000318429.7	Q96M63-1
	ODAD1	ENST00000859784.1		c.2071_2094dupACAGCGTCTGATTCGAGCGGAGGC	p.Gly698_Leu699insThrAlaSerAspSerSerGlyGly	conservative_inframe_insertion	Exon 15 of 15	ENSP00000529843.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1460876 Hom.: 0 Cov.: 32 AF XY: 0.00000275 AC XY: 2 AN XY: 726822

African (AFR) AF: 0.0000299 AC: 1 AN: 33472

American (AMR) AF: 0.00 AC: 0 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26124

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86246

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52892

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5742

European-Non Finnish (NFE) AF: 9.00e-7 AC: 1 AN: 1111626

Other (OTH) AF: 0.00 AC: 0 AN: 60364

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs776327192; hg19: chr19-48800322;