19-49818348-CCCGGGTCCGAGGGCCCGGCCCGCG-C

Variant names:

• chr19-49818348-CCCGGGTCCGAGGGCCCGGCCCGCG-C
• rs2073952891
• NM_030973.4:c.13_36delTCCGAGGGCCCGGCCCGCGCCGGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_030973.4(MED25):​c.13_36delTCCGAGGGCCCGGCCCGCGCCGGG​(p.Ser5_Gly12del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S5S) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MED25 NM_030973.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.73
• Publications: 0 publications found

Genes affected

MED25 (HGNC:28845): (mediator complex subunit 25) This gene encodes a component of the transcriptional coactivator complex termed the Mediator complex. This complex is required for transcription of most RNA polymerase II-dependent genes. The encoded protein plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. [provided by RefSeq, Apr 2010]

MED25 Gene-Disease associations (from GenCC):

• congenital cataract-microcephaly-nevus flammeus simplex-severe intellectual disability syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
• autosomal recessive non-syndromic intellectual disability

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Charcot-Marie-Tooth disease type 2B2

  Inheritance: AR Classification: SUPPORTIVE, NO_KNOWN Submitted by: Orphanet, ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_030973.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MED25	NM_030973.4	c.13_36delTCCGAGGGCCCGGCCCGCGCCGGG	p.Ser5_Gly12del	conservative_inframe_deletion	Exon 1 of 18	ENST00000312865.10	NP_112235.2
MED25	NM_001378355.1	c.13_36delTCCGAGGGCCCGGCCCGCGCCGGG	p.Ser5_Gly12del	conservative_inframe_deletion	Exon 1 of 18		NP_001365284.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MED25	ENST00000312865.10	c.13_36delTCCGAGGGCCCGGCCCGCGCCGGG	p.Ser5_Gly12del	conservative_inframe_deletion	Exon 1 of 18	1	NM_030973.4	ENSP00000326767.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Charcot-Marie-Tooth disease type 2 Uncertain:1

Nov 07, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not present in population databases (gnomAD no frequency). This variant, c.13_36del, results in the deletion of 8 amino acid(s) of the MED25 protein (p.Glu6_Ser13del), but otherwise preserves the integrity of the reading frame. This variant has not been reported in the literature in individuals affected with MED25-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 841790). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2073952891; hg19: chr19-50321605;