2-113130528-TATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGCATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC-T
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_173842.3(IL1RN):c.206-344_206-173del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic,risk factor (no stars).
Frequency
Consequence
NM_173842.3 intron
Scores
Clinical Significance
Conservation
Publications
- sterile multifocal osteomyelitis with periostitis and pustulosisInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_173842.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| IL1RN | NM_173842.3 | MANE Select | c.206-344_206-173del | intron | N/A | NP_776214.1 | |||
| IL1RN | NM_173841.3 | c.215-344_215-173del | intron | N/A | NP_776213.1 | ||||
| IL1RN | NM_000577.5 | c.152-344_152-173del | intron | N/A | NP_000568.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| IL1RN | ENST00000409930.4 | TSL:1 MANE Select | c.206-516_206-345del | intron | N/A | ENSP00000387173.3 | |||
| IL1RN | ENST00000259206.9 | TSL:1 | c.215-516_215-345del | intron | N/A | ENSP00000259206.5 | |||
| IL1RN | ENST00000354115.6 | TSL:1 | c.152-516_152-345del | intron | N/A | ENSP00000329072.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Gastric cancer susceptibility after h. pylori infection Pathogenic:1
Microvascular complications of diabetes, susceptibility to, 4 Other:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at