2-126690251-ACAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG-A

Variant names:

• chr2-126690251-ACAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG-A
• NM_002101.5:c.50_106delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002101.5(GYPC):​c.50_106delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG variant causes a exon loss, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Affects (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: GYPC NM_002101.5 exon_loss, splice_region
• Clinical Significance: Affects no assertion criteria provided O:1
• Conservation: PhyloP100: 2.50
• Publications: 0 publications found

Genes affected

GYPC (HGNC:4704): (glycophorin C (Gerbich blood group)) Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

GYPC Gene-Disease associations (from GenCC):

• hereditary elliptocytosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GYPC	NM_002101.5	c.50_106delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG		exon_loss_variant, splice_region_variant	Exon 2 of 4	ENST00000259254.9	NP_002092.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GYPC	ENST00000356887.12	c.-14-3_40delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG	p.Met1_Ala14del	start_lost, conservative_inframe_deletion, splice_region_variant	Exon 3 of 5	1		ENSP00000349354.7
GYPC	ENST00000259254.9	c.50-3_103delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG	p.Glu17_Ile34del	splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 2 of 4	1	NM_002101.5	ENSP00000259254.4
GYPC	ENST00000409836.3	c.50-3612_50-3556delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG		intron_variant	Intron 1 of 2	1		ENSP00000386904.3
GYPC	ENST00000356887.12	c.-14-3_40delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG		splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant	Exon 3 of 5	1		ENSP00000349354.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Affects

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Blood group, Gerbich system Other:1

Feb 01, 1991

OMIM

Significance: Affects

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr2-127447827;