2-126690251-ACAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG-A

Variant names:

• chr2-126690251-ACAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG-A
• NM_002101.5:c.50_106delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The ENST00000356887.12(GYPC):​c.-14-3_40delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG​(p.Met1_Ala14del) variant causes a start lost, conservative inframe deletion, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Affects (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: GYPC ENST00000356887.12 start_lost, conservative_inframe_deletion, splice_region
• Clinical Significance: Affects no assertion criteria provided O:1
• Conservation: PhyloP100: 2.50
• Publications: 0 publications found

Genes affected

GYPC (HGNC:4704): (glycophorin C (Gerbich blood group)) Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

GYPC Gene-Disease associations (from GenCC):

• hereditary elliptocytosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000356887.12.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000356887.12. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GYPC	NM_002101.5	MANE Select	c.50_106delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG		exon_loss splice_region	Exon 2 of 4	NP_002092.1	P04921-1
	GYPC	NM_001256584.2		c.-14_43delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG		5_prime_UTR_truncation exon_loss	Exon 3 of 5	NP_001243513.1	P04921-2
	GYPC	NM_001256584.2		c.-14_43delAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG		exon_loss splice_region	Exon 3 of 5	NP_001243513.1	P04921-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GYPC	ENST00000356887.12	TSL:1	c.-14-3_40delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG	p.Met1_Ala14del	start_lost conservative_inframe_deletion splice_region	Exon 3 of 5	ENSP00000349354.7	P04921-2
	GYPC	ENST00000259254.9	TSL:1 MANE Select	c.50-3_103delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG	p.Glu17_Ile34del	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 2 of 4	ENSP00000259254.4	P04921-1
	GYPC	ENST00000409836.3	TSL:1	c.50-3612_50-3556delCAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTG		intron	N/A	ENSP00000386904.3	P04921-3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Affects

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	-	Blood group, Gerbich system (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr2-127447827;