2-127639258-GAGGCAGCTGCGCAAGAGGGCCTTC-G

Position:

• chr2-127639258-GAGGCAGCTGCGCAAGAGGGCCTTC-G

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 4P and 4B. PM2 PM4 BS2

The NM_001161403.3(LIMS2):​c.1025_*22delGAAGGCCCTCTTGCGCAGCTGCCT​(p.Ter342delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000343 in 1,458,876 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000034 (0 hom.)
• Consequence: LIMS2 NM_001161403.3 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.399

Genes affected

LIMS2 (HGNC:16084): (LIM zinc finger domain containing 2) This gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The encoded protein has five LIM domains, each domain forming two zinc fingers, which permit interactions which regulate cell shape and migration. A pseudogene of this gene is located on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

LIMS2 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Stoplost variant in NM_001161403.3
• BS2: High AC in GnomAdExome4 at 5 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LIMS2	NM_001161403.3	c.1025_*22delGAAGGCCCTCTTGCGCAGCTGCCT	p.Ter342delins???	stop_lost, conservative_inframe_deletion	10/10	ENST00000355119.9	NP_001154875.1
LIMS2	NM_001161403.3	c.1021_*22delGAAGGCCCTCTTGCGCAGCTGCCT		3_prime_UTR_variant	10/10	ENST00000355119.9	NP_001154875.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LIMS2	ENST00000355119.9	c.1025_*22delGAAGGCCCTCTTGCGCAGCTGCCT	p.Ter342delins???	stop_lost, conservative_inframe_deletion	10/10	1	NM_001161403.3	ENSP00000347240.4
LIMS2	ENST00000355119	c.1026_*22delGAAGGCCCTCTTGCGCAGCTGCCT		3_prime_UTR_variant	10/10	1	NM_001161403.3	ENSP00000347240.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000343 AC: 5 AN: 1458876 Hom.: 0 AF XY: 0.00000414 AC XY: 3 AN XY: 725506

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000581

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2W Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Revvity Omics, Revvity

Jan 22, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-128396833;