2-151727801-ATGCTGGCTGTGCCAG-ATGCTGGCTGTGCCAGTGCTGGCTGTGCCAGTGCTGGCTGTGCCAG

Variant names:

• chr2-151727801-A-ATGCTGGCTGTGCCAGTGCTGGCTGTGCCAG
• rs377452683
• NM_001164507.2:c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001164507.2(NEB):​c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA​(p.Ala61_Ser62insLeuAlaGlnProAlaLeuAlaGlnProAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000186 in 1,611,888 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A61A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: NEB NM_001164507.2 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.579
• Publications: 0 publications found

Genes affected

NEB (HGNC:7720): (nebulin) This gene encodes nebulin, a giant protein component of the cytoskeletal matrix that coexists with the thick and thin filaments within the sarcomeres of skeletal muscle. In most vertebrates, nebulin accounts for 3 to 4% of the total myofibrillar protein. The encoded protein contains approximately 30-amino acid long modules that can be classified into 7 types and other repeated modules. Protein isoform sizes vary from 600 to 800 kD due to alternative splicing that is tissue-, species-,and developmental stage-specific. Of the 183 exons in the nebulin gene, at least 43 are alternatively spliced, although exons 143 and 144 are not found in the same transcript. Of the several thousand transcript variants predicted for nebulin, the RefSeq Project has decided to create three representative RefSeq records. Mutations in this gene are associated with recessive nemaline myopathy. [provided by RefSeq, Sep 2009]

NEB Gene-Disease associations (from GenCC):

• nemaline myopathy 2

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P, Ambry Genetics
• childhood-onset nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• intermediate nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• typical nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• severe congenital nemaline myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001164507.2

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NEB	NM_001164507.2	c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA	p.Ala61_Ser62insLeuAlaGlnProAlaLeuAlaGlnProAla	conservative_inframe_insertion	Exon 5 of 182	ENST00000427231.7	NP_001157979.2
NEB	NM_001164508.2	c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA	p.Ala61_Ser62insLeuAlaGlnProAlaLeuAlaGlnProAla	conservative_inframe_insertion	Exon 5 of 182	ENST00000397345.8	NP_001157980.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NEB	ENST00000397345.8	c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA	p.Ala61_Ser62insLeuAlaGlnProAlaLeuAlaGlnProAla	conservative_inframe_insertion	Exon 5 of 182	5	NM_001164508.2	ENSP00000380505.3
NEB	ENST00000427231.7	c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA	p.Ala61_Ser62insLeuAlaGlnProAlaLeuAlaGlnProAla	conservative_inframe_insertion	Exon 5 of 182	5	NM_001164507.2	ENSP00000416578.2
NEB	ENST00000409198.5	c.154_183dupCTGGCACAGCCAGCACTGGCACAGCCAGCA	p.Ala61_Ser62insLeuAlaGlnProAlaLeuAlaGlnProAla	conservative_inframe_insertion	Exon 5 of 150	5		ENSP00000386259.1

Frequencies

GnomAD3 genomes AF: 0.00000658 AC: 1 AN: 152048 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1459840 Hom.: 0 Cov.: 31 AF XY: 0.00000275 AC XY: 2 AN XY: 726092

African (AFR) AF: 0.00 AC: 0 AN: 33456

American (AMR) AF: 0.00 AC: 0 AN: 44622

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26128

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 85612

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53392

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5744

European-Non Finnish (NFE) AF: 9.00e-7 AC: 1 AN: 1110910

Other (OTH) AF: 0.0000166 AC: 1 AN: 60278

GnomAD4 genome AF: 0.00000658 AC: 1 AN: 152048 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74272

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41402

American (AMR) AF: 0.00 AC: 0 AN: 15260

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5192

South Asian (SAS) AF: 0.00 AC: 0 AN: 4772

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2088

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.58
Mutation Taster		=87/13	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs377452683; hg19: chr2-152584315;