2-218271383-ATTCTCGCAGGAGCCACAGCTAACAAGGC-A

Variant names:

• chr2-218271383-ATTCTCGCAGGAGCCACAGCTAACAAGGC-A
• rs780123062
• NM_015488.5:c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6

The NM_015488.5(PNKD):​c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC​(p.Ala26IlefsTer38) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000558 in 1,613,582 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 33)
  • Exomes 𝑓: 0.000060 (0 hom.)
• Consequence: PNKD NM_015488.5 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: 4.05
• Publications: 0 publications found

Genes affected

PNKD (HGNC:9153): (PNKD metallo-beta-lactamase domain containing) This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]

PNKD Gene-Disease associations (from GenCC):

• paroxysmal nonkinesigenic dyskinesia 1

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• Tourette syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP6: Variant 2-218271383-ATTCTCGCAGGAGCCACAGCTAACAAGGC-A is Benign according to our data. Variant chr2-218271383-ATTCTCGCAGGAGCCACAGCTAACAAGGC-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 468635.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015488.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PNKD	NM_015488.5	MANE Select	c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC	p.Ala26IlefsTer38	frameshift	Exon 2 of 10	NP_056303.3
	PNKD	NM_001077399.3		c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC	p.Ala26IlefsTer38	frameshift	Exon 2 of 3	NP_001070867.1	Q8N490-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PNKD	ENST00000273077.9	TSL:1 MANE Select	c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC	p.Ala26IlefsTer38	frameshift	Exon 2 of 10	ENSP00000273077.4	Q8N490-1
	PNKD	ENST00000248451.7	TSL:1	c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC	p.Ala26IlefsTer38	frameshift	Exon 2 of 3	ENSP00000248451.3	Q8N490-2
	PNKD	ENST00000685415.1		c.76_103delGCAGGAGCCACAGCTAACAAGGCTTCTC	p.Ala26IlefsTer38	frameshift	Exon 2 of 11	ENSP00000510415.1	A0A8I5KXK0

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 151980 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000398 AC: 10 AN: 251326 AF XY: 0.0000442

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000792

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000595 AC: 87 AN: 1461602 Hom.: 0 AF XY: 0.0000729 AC XY: 53 AN XY: 727106

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.0000224 AC: 1 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53404

Middle Eastern (MID) AF: 0.000174 AC: 1 AN: 5760

European-Non Finnish (NFE) AF: 0.0000765 AC: 85 AN: 1111792

Other (OTH) AF: 0.00 AC: 0 AN: 60380

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 151980 Hom.: 0 Cov.: 33 AF XY: 0.0000270 AC XY: 2 AN XY: 74200

African (AFR) AF: 0.00 AC: 0 AN: 41350

American (AMR) AF: 0.00 AC: 0 AN: 15264

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5188

South Asian (SAS) AF: 0.00 AC: 0 AN: 4814

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10556

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68026

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.0000434 Hom.: 0

Bravo AF: 0.0000340

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
-	-	1	Paroxysmal nonkinesigenic dyskinesia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0
Mutation Taster		=35/165	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs780123062; hg19: chr2-219136106;