2-47369502-CAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG-C

Position:

• chr2-47369502-CAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_002354.3(EPCAM):​c.-3_76delAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG​(p.Met1fs) variant causes a frameshift, start lost, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: EPCAM NM_002354.3 frameshift, start_lost, splice_region
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 2.41

Genes affected

EPCAM (HGNC:11529): (epithelial cell adhesion molecule) This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]

EPCAM (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 22 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
EPCAM	NM_002354.3	c.-3_76delAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	1/9	ENST00000263735.9	NP_002345.2
EPCAM	NM_002354.3	c.-3_75+1delAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG		5_prime_UTR_variant	1/9	ENST00000263735.9	NP_002345.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
EPCAM	ENST00000263735.9	c.-3_76delAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	1/9	1	NM_002354.3	ENSP00000263735.4
EPCAM	ENST00000263735	c.-3_75+1delAGCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAG		5_prime_UTR_variant	1/9	1	NM_002354.3	ENSP00000263735.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

Lynch syndrome 8 Uncertain:1

Uncertain significance, no assertion criteria provided

clinical testing

Department of Pathology and Laboratory Medicine, Sinai Health System

-

The EPCAM c.1-?_76+?del variant (chr:2 g.47596645_47596720del GRCh37) results in a deletion of exon 1, although the precise breakpoints of this deletion were not determined, nor were the effects of this variant on the resulting mRNA or protein product determined. The c.1-?_76+?del variant was not identified in the literature nor was it identified in the dbSNP, and ClinVar, databases. The variant was not identified in the following control databases: the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). This alteration is predicted to result in a truncated or absent EPCAM protein and loss of function. However loss of function is not the mechanism through which EPCAM causes Lynch Syndrome. EPCAM 3’ deletions are known to silence MSH2 due to transcriptional read-through inducing hypermethylation of the upstream MSH2 promoter and gene silencing in tissues where EPCAM is normally expressed (Ligtenberg 2009, Kovacs 2009). In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time. This variant is classified as a variant of uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-47596641;