2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G

Variant names:

• chr2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G
• rs876660118
• NM_000179.3:c.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA

Variant summary

Our verdict is Pathogenic. The variant received 14 ACMG points: 14P and 0B. PVS1 PS3 PP5_Moderate

The NM_000179.3(MSH6):​c.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA​(p.Lys1319SerfsTer13) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV000277280: Based on internal structural analysis, this variant sits at the dimerization interface and is anticipated to result in a significant decrease in structural stability (Warren JJ et al. Mol Cell. 2007 May 25" and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. K1319K) has been classified as Likely benign. The gene MSH6 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH6 NM_000179.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.28
• Publications: 3 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Specifications for MSH6 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 69 pathogenic variants in the truncated region.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000277280: Based on internal structural analysis, this variant sits at the dimerization interface and is anticipated to result in a significant decrease in structural stability (Warren JJ et al. Mol Cell. 2007 May 25;26(4):579-92).
• PP5: Variant 2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G is Pathogenic according to our data. Variant chr2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 232993.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	NM_000179.3	MANE Select	c.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA	p.Lys1319SerfsTer13	frameshift	Exon 9 of 10	NP_000170.1	P52701-1
	MSH6	NM_001406795.1		c.4051_4076delAAAGCAAGAGAATTTGAGAAGATGAA	p.Lys1351SerfsTer13	frameshift	Exon 10 of 11	NP_001393724.1
	MSH6	NM_001406813.1		c.3961_3986delAAAGCAAGAGAATTTGAGAAGATGAA	p.Lys1321SerfsTer13	frameshift	Exon 9 of 10	NP_001393742.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	ENST00000234420.11	TSL:1 MANE Select	c.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA	p.Lys1319SerfsTer13	frameshift	Exon 9 of 10	ENSP00000234420.5	P52701-1
	MSH6	ENST00000445503.5	TSL:1	n.*3302_*3327delAAAGCAAGAGAATTTGAGAAGATGAA		non_coding_transcript_exon	Exon 8 of 9	ENSP00000405294.1	F8WAX8
	MSH6	ENST00000445503.5	TSL:1	n.*3302_*3327delAAAGCAAGAGAATTTGAGAAGATGAA		3_prime_UTR	Exon 8 of 9	ENSP00000405294.1	F8WAX8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876660118; hg19: chr2-48033742;