2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_000179.3(MSH6):​c.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA​(p.Lys1319fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

MSH6
NM_000179.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.28
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 5 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G is Pathogenic according to our data. Variant chr2-47806603-GAAAAGCAAGAGAATTTGAGAAGATGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 232993.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MSH6NM_000179.3 linkuse as main transcriptc.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA p.Lys1319fs frameshift_variant 9/10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkuse as main transcriptc.3955_3980delAAAGCAAGAGAATTTGAGAAGATGAA p.Lys1319fs frameshift_variant 9/101 NM_000179.3 ENSP00000234420.5 P52701-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAmbry GeneticsAug 07, 2015The c.3955_3980del26 pathogenic mutation (also known as p.K1319Sfs*13), located in coding exon 9 of the MSH6 gene, results from a deletion of 26 nucleotides between positions 3955 and 3980, causing a translational frameshift with a predicted alternate stop codon. While this specific mutation has not been reported in the literature to date, other frameshift mutations occurring further downstream have been identified in HNPCC families and are classified as pathogenic (Thompson B et al. Nat Genet. 2014 Feb;46(2):107-15; available at [www.insight-group.org/variants/classifications/]). Based on internal structural analysis, this variant sits at the dimerization interface and is anticipated to result in a significant decrease in structural stability (Warren JJ et al. Mol Cell. 2007 May 25;26(4):579-92). In addition to the data presented in the literature, since frameshifts are typically deleterious in nature, this alteration is interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med. 2008;10:294). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs876660118; hg19: chr2-48033742; API