20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A

Variant names:

• chr20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A
• rs2122274245
• NM_033453.4:c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_033453.4(ITPA):​c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC​(p.Ala17_Glu22del) variant causes a splice donor, conservative inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ITPA NM_033453.4 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.67
• Publications: 0 publications found

Genes affected

ITPA (HGNC:6176): (inosine triphosphatase) This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]

ITPA Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• developmental and epileptic encephalopathy, 35

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
• inosine triphosphatase deficiency

  Inheritance: AR Classification: MODERATE Submitted by: Ambry Genetics

ENSG00000289494 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.20512821 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PP5: Variant 20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A is Pathogenic according to our data. Variant chr20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 1066265.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033453.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ITPA	NM_033453.4	MANE Select	c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC	p.Ala17_Glu22del	splice_donor conservative_inframe_deletion splice_region intron	Exon 1 of 8	NP_258412.1	A0A0S2Z3W7
	ITPA	NM_001324236.2		c.-292_-275+4delGCCAAGAAGCTGGAGGAGGTGC		splice_region	Exon 1 of 7	NP_001311165.1	Q8WWI0
	ITPA	NM_001424408.1		c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC	p.Ala17_Glu22del	splice_donor conservative_inframe_deletion splice_region intron	Exon 1 of 9	NP_001411337.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ITPA	ENST00000380113.8	TSL:1 MANE Select	c.48_66+3delCGCCAAGAAGCTGGAGGAGGTG	p.Asn16LysfsTer5	frameshift splice_donor splice_region intron	Exon 1 of 8	ENSP00000369456.3	Q9BY32-1
	ITPA	ENST00000455664.6	TSL:1	c.15+33_15+54delCGCCAAGAAGCTGGAGGAGGTG		intron	N/A	ENSP00000413282.1	Q9BY32-2
	ITPA	ENST00000399838.3	TSL:1	c.48_66+3delCGCCAAGAAGCTGGAGGAGGTG	p.Asn16ArgfsTer24	frameshift splice_donor splice_region intron	Exon 1 of 6	ENSP00000382732.3	Q9BY32-3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Inosine triphosphatase deficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2122274245; hg19: chr20-3190244;