20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A

Position:

• chr20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_033453.4(ITPA):​c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC​(p.Ala17_Glu22del) variant causes a splice donor, conservative inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ITPA NM_033453.4 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.67

Genes affected

ITPA (HGNC:6176): (inosine triphosphatase) This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]

ITPA (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.2034188 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A is Pathogenic according to our data. Variant chr20-3209598-ACGCCAAGAAGCTGGAGGAGGTG-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1066265.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ITPA	NM_033453.4	c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC	p.Ala17_Glu22del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	1/8	ENST00000380113.8	NP_258412.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ITPA	ENST00000380113.8	c.49_66+4delGCCAAGAAGCTGGAGGAGGTGC	p.Ala17_Glu22del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	1/8	1	NM_033453.4	ENSP00000369456.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inosine triphosphatase deficiency Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Feb 13, 2020

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Loss-of-function variants in ITPA are known to be pathogenic (PMID: 26224535). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with ITPA-related conditions. This variant is not present in population databases (ExAC no frequency). This variant results in the deletion of part of exon 1 (c.49_66+4del) of the ITPA gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr20-3190244;