20-46724875-CGGATGGATGGAT-CGGATGGATGGATGGATGGATGGATGGATGGAT

Variant names:

• chr20-46724875-C-CGGATGGATGGATGGATGGAT
• rs3092014
• NM_030777.4:c.5-155_5-136dupATGGATGGATGGATGGATGG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_030777.4(SLC2A10):​c.5-155_5-136dupATGGATGGATGGATGGATGG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0017 (2 hom., cov: 0)
• Consequence: SLC2A10 NM_030777.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.234
• Publications: 0 publications found

Genes affected

SLC2A10 (HGNC:13444): (solute carrier family 2 member 10) This gene encodes a member of the class III facilitative glucose transporter family. The encoded protein plays a role in regulation of glucose homeostasis. Mutations in this gene have been associated with arterial tortuosity syndrome.[provided by RefSeq, Dec 2009]

SLC2A10 Gene-Disease associations (from GenCC):

• arterial tortuosity syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet, G2P
• familial thoracic aortic aneurysm and aortic dissection

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.0017 (238/139866) while in subpopulation SAS AF = 0.00638 (26/4078). AF 95% confidence interval is 0.00447. There are 2 homozygotes in GnomAd4. There are 133 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 2 AR,AD gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC2A10	NM_030777.4	c.5-155_5-136dupATGGATGGATGGATGGATGG		intron_variant	Intron 1 of 4	ENST00000359271.4	NP_110404.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC2A10	ENST00000359271.4	c.5-166_5-165insGGATGGATGGATGGATGGAT		intron_variant	Intron 1 of 4	1	NM_030777.4	ENSP00000352216.2
SLC2A10	ENST00000611837.1	n.157-166_157-165insGGATGGATGGATGGATGGAT		intron_variant	Intron 1 of 1	2

Frequencies

GnomAD3 genomes AF: 0.00170 AC: 238 AN: 139750 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.00202

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00112

Gnomad ASJ AF: 0.000886

Gnomad EAS AF: 0.00134

Gnomad SAS AF: 0.00637

Gnomad FIN AF: 0.00629

Gnomad MID AF: 0.00690

Gnomad NFE AF: 0.000781

Gnomad OTH AF: 0.00259

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00170 AC: 238 AN: 139866 Hom.: 2 Cov.: 0 AF XY: 0.00196 AC XY: 133 AN XY: 67810

African (AFR) AF: 0.00201 AC: 73 AN: 36288

American (AMR) AF: 0.00112 AC: 16 AN: 14344

Ashkenazi Jewish (ASJ) AF: 0.000886 AC: 3 AN: 3386

East Asian (EAS) AF: 0.00134 AC: 6 AN: 4478

South Asian (SAS) AF: 0.00638 AC: 26 AN: 4078

European-Finnish (FIN) AF: 0.00629 AC: 56 AN: 8902

Middle Eastern (MID) AF: 0.00735 AC: 2 AN: 272

European-Non Finnish (NFE) AF: 0.000781 AC: 51 AN: 65302

Other (OTH) AF: 0.00256 AC: 5 AN: 1950

Alfa AF: 0.000874 Hom.: 1700

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.23
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3092014; hg19: chr20-45353514;