20-63659405-G-GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC

Variant names:

• chr20-63659405-G-GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC
• NM_001283009.2:c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_001283009.2(RTEL1):​c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC​(p.Gln16ProfsTer133) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: RTEL1 NM_001283009.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.15

Genes affected

RTEL1 (HGNC:15888): (regulator of telomere elongation helicase 1) This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]

RTEL1-TNFRSF6B (HGNC:44095): (RTEL1-TNFRSF6B readthrough (NMD candidate)) This locus represents naturally occurring read-through transcription between the neighboring RTEL1 (regulator of telomere elongation helicase 1) and TNFRSF6B (tumor necrosis factor receptor superfamily, member 6b, decoy) genes on chromosome 20. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Feb 2011]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 20-63659405-G-GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC is Pathogenic according to our data. Variant chr20-63659405-G-GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC is described in ClinVar as [Pathogenic]. Clinvar id is 1456365.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RTEL1	NM_001283009.2	c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC	p.Gln16ProfsTer133	frameshift_variant	Exon 2 of 35	ENST00000360203.11	NP_001269938.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RTEL1	ENST00000360203.11	c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC	p.Gln16ProfsTer133	frameshift_variant	Exon 2 of 35	5	NM_001283009.2	ENSP00000353332.5
RTEL1	ENST00000508582.7	c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC	p.Gln16ProfsTer157	frameshift_variant	Exon 2 of 35	2		ENSP00000424307.2
RTEL1	ENST00000370018.7	c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC	p.Gln16ProfsTer133	frameshift_variant	Exon 2 of 35	1		ENSP00000359035.3
RTEL1-TNFRSF6B	ENST00000492259.6	n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC		non_coding_transcript_exon_variant	Exon 1 of 35	5		ENSP00000457428.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Dyskeratosis congenita, autosomal recessive 5;C4225346:Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 3 Pathogenic:1

Apr 02, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gln16Profs*133) in the RTEL1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RTEL1 are known to be pathogenic (PMID: 23453664, 23959892, 25607374). This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with RTEL1-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr20-62290758;