20-63659405-G-GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001283009.2(RTEL1):c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC(p.Gln16ProfsTer133) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_001283009.2 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RTEL1 | ENST00000360203.11 | c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC | p.Gln16ProfsTer133 | frameshift_variant | Exon 2 of 35 | 5 | NM_001283009.2 | ENSP00000353332.5 | ||
RTEL1 | ENST00000508582.7 | c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC | p.Gln16ProfsTer157 | frameshift_variant | Exon 2 of 35 | 2 | ENSP00000424307.2 | |||
RTEL1 | ENST00000370018.7 | c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC | p.Gln16ProfsTer133 | frameshift_variant | Exon 2 of 35 | 1 | ENSP00000359035.3 | |||
RTEL1-TNFRSF6B | ENST00000492259.6 | n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC | non_coding_transcript_exon_variant | Exon 1 of 35 | 5 | ENSP00000457428.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Dyskeratosis congenita, autosomal recessive 5;C4225346:Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 3 Pathogenic:1
This sequence change creates a premature translational stop signal (p.Gln16Profs*133) in the RTEL1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RTEL1 are known to be pathogenic (PMID: 23453664, 23959892, 25607374). This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with RTEL1-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at