21-44509026-AGTCCCCAGGCCATTCTTTCCACAGGAAG-AGTCCCCAGGCCATTCTTTCCACAGGAAGGTCCCCAGGCCATTCTTTCCACAGGAAG

Variant names:

• chr21-44509026-A-AGTCCCCAGGCCATTCTTTCCACAGGAAG
• rs879970586
• NM_144991.3:c.1754+145_1754+172dupCTTCCTGTGGAAAGAATGGCCTGGGGAC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_144991.3(TSPEAR):​c.1754+145_1754+172dupCTTCCTGTGGAAAGAATGGCCTGGGGAC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000398 in 150,814 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000040 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000014 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TSPEAR NM_144991.3 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.0540

Genes affected

TSPEAR (HGNC:1268): (thrombospondin type laminin G domain and EAR repeats) This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

TSPEAR-AS1 (HGNC:1271): (TSPEAR antisense RNA 1)

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSPEAR	NM_144991.3	c.1754+145_1754+172dupCTTCCTGTGGAAAGAATGGCCTGGGGAC		intron_variant	Intron 10 of 11	ENST00000323084.9	NP_659428.2
TSPEAR	NM_001272037.2	c.1550+145_1550+172dupCTTCCTGTGGAAAGAATGGCCTGGGGAC		intron_variant	Intron 11 of 12		NP_001258966.1
TSPEAR-AS1	NR_103707.1	n.1214+138_1215-158dupTTCTTTCCACAGGAAGGTCCCCAGGCCA		intron_variant	Intron 4 of 6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSPEAR	ENST00000323084.9	c.1754+172_1754+173insCTTCCTGTGGAAAGAATGGCCTGGGGAC		intron_variant	Intron 10 of 11	1	NM_144991.3	ENSP00000321987.4
TSPEAR	ENST00000397916.1	n.1710-116_1710-115insCTTCCTGTGGAAAGAATGGCCTGGGGAC		intron_variant	Intron 10 of 10	1
TSPEAR-AS1	ENST00000451035.2	n.769+97_769+98insGTCCCCAGGCCATTCTTTCCACAGGAAG		intron_variant	Intron 3 of 5	5
TSPEAR	ENST00000642437.1	n.*1699+172_*1699+173insCTTCCTGTGGAAAGAATGGCCTGGGGAC		intron_variant	Intron 11 of 12			ENSP00000496535.1

Frequencies

GnomAD3 genomes AF: 0.0000398 AC: 6 AN: 150814 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000248

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000289

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000944

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000442

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000138 AC: 18 AN: 1300474 Hom.: 0 Cov.: 20 AF XY: 0.0000125 AC XY: 8 AN XY: 641888

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000576

Gnomad4 SAS exome AF: 0.0000395

Gnomad4 FIN exome AF: 0.0000442

Gnomad4 NFE exome AF: 0.0000100

Gnomad4 OTH exome AF: 0.0000184

GnomAD4 genome AF: 0.0000398 AC: 6 AN: 150814 Hom.: 0 Cov.: 32 AF XY: 0.0000272 AC XY: 2 AN XY: 73662

Gnomad4 AFR AF: 0.0000248

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.000289

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.0000944

Gnomad4 NFE AF: 0.0000442

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879970586; hg19: chr21-45928909;