22-20564609-TGCAGCAGCAGCAGCAGCTCCAGCAGCA-T

Variant names:

• chr22-20564609-TGCAGCAGCAGCAGCAGCTCCAGCAGCA-T
• rs763835447
• NM_001003891.3:c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_001003891.3(MED15):​c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Leu210_Gln218del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000135 in 1,608,030 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.00061 (0 hom., cov: 33)
  • Exomes 𝑓: 0.000085 (0 hom.)
• Consequence: MED15 NM_001003891.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.66
• Publications: 0 publications found

Genes affected

MED15 (HGNC:14248): (mediator complex subunit 15) The protein encoded by this gene is a subunit of the multiprotein complexes PC2 and ARC/DRIP and may function as a transcriptional coactivator in RNA polymerase II transcription. This gene contains stretches of trinucleotide repeats and is located in the chromosome 22 region which is deleted in DiGeorge syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

ENSG00000307622 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001003891.3
• BP6: Variant 22-20564609-TGCAGCAGCAGCAGCAGCTCCAGCAGCA-T is Benign according to our data. Variant chr22-20564609-TGCAGCAGCAGCAGCAGCTCCAGCAGCA-T is described in ClinVar as Benign. ClinVar VariationId is 2652901.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 93 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001003891.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MED15	NM_001003891.3	MANE Select	c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC	p.Leu210_Gln218del	disruptive_inframe_deletion	Exon 6 of 18	NP_001003891.1	Q96RN5-1
	MED15	NM_015889.5		c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC	p.Leu210_Gln218del	disruptive_inframe_deletion	Exon 6 of 17	NP_056973.2
	MED15	NM_001293234.2		c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC	p.Leu210_Gln218del	disruptive_inframe_deletion	Exon 6 of 17	NP_001280163.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MED15	ENST00000263205.11	TSL:1 MANE Select	c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC	p.Leu210_Gln218del	disruptive_inframe_deletion	Exon 6 of 18	ENSP00000263205.7	Q96RN5-1
	MED15	ENST00000292733.11	TSL:1	c.629_655delTCCAGCAGCAGCAGCAGCAGCAGCAGC	p.Leu210_Gln218del	disruptive_inframe_deletion	Exon 6 of 17	ENSP00000292733.7	Q96RN5-2
	MED15	ENST00000406969.5	TSL:1	c.551_577delTCCAGCAGCAGCAGCAGCAGCAGCAGC	p.Leu184_Gln192del	disruptive_inframe_deletion	Exon 6 of 17	ENSP00000384344.1	G3V1P5

Frequencies

GnomAD3 genomes AF: 0.000613 AC: 93 AN: 151622 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00218

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000659

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.000479

GnomAD2 exomes AF: 0.000155 AC: 37 AN: 238944 AF XY: 0.000108

Gnomad AFR exome AF: 0.00222

Gnomad AMR exome AF: 0.0000597

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000169

GnomAD4 exome AF: 0.0000851 AC: 124 AN: 1456290 Hom.: 0 AF XY: 0.0000828 AC XY: 60 AN XY: 724470

African (AFR) AF: 0.00279 AC: 93 AN: 33292

American (AMR) AF: 0.000112 AC: 5 AN: 44468

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26046

East Asian (EAS) AF: 0.0000253 AC: 1 AN: 39604

South Asian (SAS) AF: 0.00 AC: 0 AN: 85768

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53046

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5758

European-Non Finnish (NFE) AF: 0.0000162 AC: 18 AN: 1108164

Other (OTH) AF: 0.000116 AC: 7 AN: 60144

GnomAD4 genome AF: 0.000613 AC: 93 AN: 151740 Hom.: 0 Cov.: 33 AF XY: 0.000607 AC XY: 45 AN XY: 74180

African (AFR) AF: 0.00218 AC: 90 AN: 41358

American (AMR) AF: 0.0000658 AC: 1 AN: 15204

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.00 AC: 0 AN: 4800

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10548

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 67876

Other (OTH) AF: 0.000474 AC: 1 AN: 2108

Alfa AF: 0.000327 Hom.: 0

Bravo AF: 0.000657

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.7
Mutation Taster		=50/150	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs763835447; hg19: chr22-20918896;