22-28734649-CGCTGCCATGGGGCTGTGAACAGGCACT-C

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_007194.4(CHEK2):​c.46_72delAGTGCCTGTTCACAGCCCCATGGCAGC​(p.Ser16_Ser24del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S16S) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 31)

Consequence

CHEK2
NM_007194.4 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.81

Publications

1 publications found
Variant links:
Genes affected
CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
CHEK2 Gene-Disease associations (from GenCC):
  • CHEK2-related cancer predisposition
    Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
  • Li-Fraumeni syndrome 2
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • acute myeloid leukemia
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary nonpolyposis colon cancer
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen
  • familial ovarian cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_007194.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CHEK2NM_007194.4 linkc.46_72delAGTGCCTGTTCACAGCCCCATGGCAGC p.Ser16_Ser24del conservative_inframe_deletion Exon 2 of 15 ENST00000404276.6 NP_009125.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CHEK2ENST00000404276.6 linkc.46_72delAGTGCCTGTTCACAGCCCCATGGCAGC p.Ser16_Ser24del conservative_inframe_deletion Exon 2 of 15 1 NM_007194.4 ENSP00000385747.1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial cancer of breast Uncertain:1
Sep 09, 2020
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant has not been reported in the literature in individuals with CHEK2-related disease. This variant is not present in population databases (ExAC no frequency). This variant, c.46_72delAGTGCCTGTTCACAGCCCCATGGCAGC, results in the deletion of 9 amino acids of the CHEK2 protein (p.Ser16_Ser24del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555932835; hg19: chr22-29130637; API