22-46363187-CCTGATGGTTCAAATTGAAGTTTCATTA-C

Position:

• chr22-46363187-CCTGATGGTTCAAATTGAAGTTTCATTA-C

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_001378328.1(CELSR1):​c.*9_*35delTAATGAAACTTCAATTTGAACCATCAG variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0116 in 1,612,906 control chromosomes in the GnomAD database, including 1,832 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.062 (988 hom., cov: 32)
  • Exomes 𝑓: 0.0064 (844 hom.)
• Consequence: CELSR1 NM_001378328.1 3_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.0890

Genes affected

CELSR1 (HGNC:1850): (cadherin EGF LAG seven-pass G-type receptor 1) The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]

CELSR1 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 22-46363187-CCTGATGGTTCAAATTGAAGTTTCATTA-C is Benign according to our data. Variant chr22-46363187-CCTGATGGTTCAAATTGAAGTTTCATTA-C is described in ClinVar as [Benign]. Clinvar id is 777752.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.208 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CELSR1	NM_001378328.1	c.*9_*35delTAATGAAACTTCAATTTGAACCATCAG		3_prime_UTR_variant	35/35	ENST00000674500.2	NP_001365257.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CELSR1	ENST00000674500	c.*9_*35delTAATGAAACTTCAATTTGAACCATCAG		3_prime_UTR_variant	35/35		NM_001378328.1	ENSP00000501367.2
CELSR1	ENST00000473624.2	c.*778_*804delTAATGAAACTTCAATTTGAACCATCAG		3_prime_UTR_variant	5/5	1		ENSP00000501353.1
CELSR1	ENST00000262738.9	c.9036-27_9036-1delTAATGAAACTTCAATTTGAACCATCAG		splice_acceptor_variant, splice_region_variant, intron_variant		1		ENSP00000262738.3
CELSR1	ENST00000674159.1	n.2512_2538delTAATGAAACTTCAATTTGAACCATCAG		non_coding_transcript_exon_variant	11/11

Frequencies

GnomAD3 genomes AF: 0.0616 AC: 9362 AN: 151858 Hom.: 990 Cov.: 32

Gnomad AFR AF: 0.212

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0272

Gnomad ASJ AF: 0.00461

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000414

Gnomad FIN AF: 0.000283

Gnomad MID AF: 0.0222

Gnomad NFE AF: 0.00153

Gnomad OTH AF: 0.0469

GnomAD3 exomes AF: 0.0162 AC: 4021 AN: 248842 Hom.: 362 AF XY: 0.0118 AC XY: 1589 AN XY: 134860

Gnomad AFR exome AF: 0.212

Gnomad AMR exome AF: 0.0110

Gnomad ASJ exome AF: 0.00378

Gnomad EAS exome AF: 0.0000544

Gnomad SAS exome AF: 0.000327

Gnomad FIN exome AF: 0.000231

Gnomad NFE exome AF: 0.00117

Gnomad OTH exome AF: 0.00834

GnomAD4 exome AF: 0.00640 AC: 9355 AN: 1460932 Hom.: 844 AF XY: 0.00564 AC XY: 4096 AN XY: 726798

Gnomad4 AFR exome AF: 0.202

Gnomad4 AMR exome AF: 0.0125

Gnomad4 ASJ exome AF: 0.00463

Gnomad4 EAS exome AF: 0.000151

Gnomad4 SAS exome AF: 0.000522

Gnomad4 FIN exome AF: 0.000132

Gnomad4 NFE exome AF: 0.000914

Gnomad4 OTH exome AF: 0.0143

GnomAD4 genome AF: 0.0617 AC: 9375 AN: 151974 Hom.: 988 Cov.: 32 AF XY: 0.0591 AC XY: 4389 AN XY: 74302

Gnomad4 AFR AF: 0.212

Gnomad4 AMR AF: 0.0271

Gnomad4 ASJ AF: 0.00461

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000415

Gnomad4 FIN AF: 0.000283

Gnomad4 NFE AF: 0.00153

Gnomad4 OTH AF: 0.0464

Alfa AF: 0.0300 Hom.: 78

Asia WGS AF: 0.00895 AC: 31 AN: 3478

EpiCase AF: 0.00131

EpiControl AF: 0.00142

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 31, 2019

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs576512903; hg19: chr22-46759084;