22-50674600-TTCCCCGGCGCGAGCGGCCCCGGCCCGG-T

Variant names:

• chr22-50674600-TTCCCCGGCGCGAGCGGCCCCGGCCCGG-T
• ENST00000692848:c.-41_-15delTCCCCGGCGCGAGCGGCCCCGGCCCGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001372044.2(SHANK3):​c.185_211delTCCCCGGCGCGAGCGGCCCCGGCCCGG​(p.Phe62_Gly71delinsCys) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 28)
• Consequence: SHANK3 NM_001372044.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 2.11

Genes affected

SHANK3 (HGNC:14294): (SH3 and multiple ankyrin repeat domains 3) This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001372044.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SHANK3	NM_001372044.2	c.185_211delTCCCCGGCGCGAGCGGCCCCGGCCCGG	p.Phe62_Gly71delinsCys	disruptive_inframe_deletion	Exon 3 of 25		NP_001358973.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SHANK3	ENST00000692848	c.-41_-15delTCCCCGGCGCGAGCGGCCCCGGCCCGG		5_prime_UTR_variant	Exon 1 of 10			ENSP00000510794.2
SHANK3	ENST00000414786.7	n.187_213delTCCCCGGCGCGAGCGGCCCCGGCCCGG		non_coding_transcript_exon_variant	Exon 1 of 23	5
SHANK3	ENST00000673971.2	n.-41_-15delTCCCCGGCGCGAGCGGCCCCGGCCCGG		non_coding_transcript_exon_variant	Exon 1 of 23			ENSP00000501192.2
SHANK3	ENST00000673971.2	n.-41_-15delTCCCCGGCGCGAGCGGCCCCGGCCCGG		5_prime_UTR_variant	Exon 1 of 23			ENSP00000501192.2

Frequencies

GnomAD3 genomes Cov.: 28

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 28

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

Phelan-McDermid syndrome Uncertain:1

Sep 16, 2024

Diagnostics Centre, Carl Von Ossietzky University Oldenburg

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The variant in the exon 3 causes a change in protein length as a result of an in-frame deletion/insertion at nucleotide position 182 to 211. This change causes a deletion of the amino acid phenylalanine at position 62 to glycine at position 71 and an insertion of a cysteine. This variant is classified as very rare since it is absent in gnomAD v4.1.0. Segregation of the parents revealed a de novo occurrence in the patient. In summary, the variant is classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr22-51113028;