3-10141785-CGCCCCGCGTCCGACCCGCGG-C

Variant names:

• chr3-10141785-CGCCCCGCGTCCGACCCGCGG-C
• NM_000551.4:c.-62_-43delGCCCCGCGTCCGACCCGCGG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000551.4(VHL):​c.-62_-43delGCCCCGCGTCCGACCCGCGG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.73

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VHL	NM_000551.4	c.-62_-43delGCCCCGCGTCCGACCCGCGG		5_prime_UTR_variant	Exon 1 of 3	ENST00000256474.3	NP_000542.1
VHL	NM_001354723.2	c.-62_-43delGCCCCGCGTCCGACCCGCGG		5_prime_UTR_variant	Exon 1 of 3		NP_001341652.1
VHL	NM_198156.3	c.-62_-43delGCCCCGCGTCCGACCCGCGG		5_prime_UTR_variant	Exon 1 of 2		NP_937799.1
VHL	NR_176335.1	n.9_28delGCCCCGCGTCCGACCCGCGG		non_coding_transcript_exon_variant	Exon 1 of 4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474.3	c.-62_-43delGCCCCGCGTCCGACCCGCGG		5_prime_UTR_variant	Exon 1 of 3	1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Mar 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

VHL: PM2 -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

You must be logged in to view publications. This limit was set because tens of millions (!) of queries from AI bots are generated daily.

Other links and lift over

hg19: chr3-10183469;