3-10141790-C-CGCGTCCGACCCGCGGATCCCGCG

Variant names:

• chr3-10141790-C-CGCGTCCGACCCGCGGATCCCGCG
• rs1298211819
• NM_000551.4:c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000551.4(VHL):​c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000327 in 1,528,032 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000029 (0 hom.)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: -0.222
• Publications: 0 publications found

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL Gene-Disease associations (from GenCC):

• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• von Hippel-Lindau disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp, G2P
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal recessive secondary polycythemia not associated with VHL gene

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Chuvash polycythemia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000551.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	NM_000551.4	MANE Select	c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR	Exon 1 of 3	NP_000542.1	A0A024R2F2
	VHL	NM_001354723.2		c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR	Exon 1 of 3	NP_001341652.1	A0A8Q3WL21
	VHL	NM_198156.3		c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR	Exon 1 of 2	NP_937799.1	A0A0S2Z4K1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	ENST00000256474.3	TSL:1 MANE Select	c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR	Exon 1 of 3	ENSP00000256474.3	P40337-1
	VHL	ENST00000345392.3	TSL:1	c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR	Exon 1 of 2	ENSP00000344757.2	P40337-2
	VHL	ENST00000477538.2	TSL:1	n.-4_19dupACCCGCGGATCCCGCGGCGTCCG		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152244 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000291 AC: 4 AN: 1375788 Hom.: 0 Cov.: 30 AF XY: 0.00000295 AC XY: 2 AN XY: 678204

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 30686

American (AMR) AF: 0.00 AC: 0 AN: 33976

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24672

East Asian (EAS) AF: 0.0000567 AC: 2 AN: 35298

South Asian (SAS) AF: 0.00 AC: 0 AN: 78222

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46634

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4016

European-Non Finnish (NFE) AF: 0.00000188 AC: 2 AN: 1065366

Other (OTH) AF: 0.00 AC: 0 AN: 56918

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00955443), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152244 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74374

African (AFR) AF: 0.0000241 AC: 1 AN: 41468

American (AMR) AF: 0.00 AC: 0 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4836

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68036

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Von Hippel-Lindau syndrome (1)
-	1	-	Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.22

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1298211819; hg19: chr3-10183474;