3-10141790-C-CGCGTCCGACCCGCGGATCCCGCG
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_000551.4(VHL):c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000327 in 1,528,032 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000551.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
VHL | NM_000551.4 | c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG | 5_prime_UTR_variant | Exon 1 of 3 | ENST00000256474.3 | NP_000542.1 | ||
VHL | NM_001354723.2 | c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG | 5_prime_UTR_variant | Exon 1 of 3 | NP_001341652.1 | |||
VHL | NM_198156.3 | c.-50_-28dupACCCGCGGATCCCGCGGCGTCCG | 5_prime_UTR_variant | Exon 1 of 2 | NP_937799.1 | |||
VHL | NR_176335.1 | n.21_43dupACCCGCGGATCCCGCGGCGTCCG | non_coding_transcript_exon_variant | Exon 1 of 4 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152244Hom.: 0 Cov.: 33
GnomAD4 exome AF: 0.00000291 AC: 4AN: 1375788Hom.: 0 Cov.: 30 AF XY: 0.00000295 AC XY: 2AN XY: 678204
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152244Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74374
ClinVar
Submissions by phenotype
Von Hippel-Lindau syndrome Uncertain:1
This variant causes a 23-basepair duplication in the 5' untranslated region of the VHL gene. This duplication c.-50_-28dup is distal to the Kozak consensus sequence and the translation initiation codon. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with VHL-related disorders in the literature. This variant has been identified in 1/31314 chromosomes in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia Uncertain:1
This variant occurs in a non-coding region of the VHL gene. It does not change the encoded amino acid sequence of the VHL protein. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with VHL-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at