3-141487086-GGCGGCGGCGGCGCCTGCTGCT-GGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCT

Variant names:

• chr3-141487086-G-GGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCT
• rs1194909078
• NM_006506.5:c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_006506.5(RASA2):​c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC​(p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000133 in 150,376 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.000013 (0 hom., cov: 32)
• Consequence: RASA2 NM_006506.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.59
• Publications: 0 publications found

Genes affected

RASA2 (HGNC:9872): (RAS p21 protein activator 2) The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

RASA2 Gene-Disease associations (from GenCC):

• Noonan syndrome

  Inheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
• cardiofaciocutaneous syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Costello syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome with multiple lentigines

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome-like disorder with loose anagen hair

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006506.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006506.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA2	NM_006506.5	MANE Select	c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	NP_006497.2
	RASA2	NM_001303246.3		c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25	NP_001290175.1
	RASA2	NM_001303245.3		c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	NP_001290174.1	Q15283-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA2	ENST00000286364.9	TSL:1 MANE Select	c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	ENSP00000286364.3	Q15283-2
	RASA2	ENST00000930693.1		c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25	ENSP00000600752.1
	RASA2	ENST00000950127.1		c.32_33insGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAlaAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25	ENSP00000620186.1

Frequencies

GnomAD3 genomes AF: 0.0000133 AC: 2 AN: 150376 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000485

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 31

GnomAD4 genome AF: 0.0000133 AC: 2 AN: 150376 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 73410

African (AFR) AF: 0.0000485 AC: 2 AN: 41228

American (AMR) AF: 0.00 AC: 0 AN: 15088

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3444

East Asian (EAS) AF: 0.00 AC: 0 AN: 5164

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9876

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67448

Other (OTH) AF: 0.00 AC: 0 AN: 2068

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6
Mutation Taster		=77/23	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1194909078; hg19: chr3-141205928;