3-181712418-G-GGCGGCGGCGGCAACTCCACC

Variant names:

• chr3-181712418-G-GGCGGCGGCGGCAACTCCACC
• rs398123693
• NM_003106.4:c.70_89dupAACTCCACCGCGGCGGCGGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_003106.4(SOX2):​c.70_89dupAACTCCACCGCGGCGGCGGC​(p.Gly31ThrfsTer22) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SOX2 NM_003106.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.23
• Publications: 0 publications found

Genes affected

SOX2 (HGNC:11195): (SRY-box transcription factor 2) This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]

SOX2-OT (HGNC:20209): (SOX2 overlapping transcript) This gene produces alternatively spliced long non-coding RNAs. These RNAs were observed to be upregulated in tumor cells and positively correlated to expression of the SRY-box 2 gene. Overexpression of these transcripts may promote cell proliferation. [provided by RefSeq, Dec 2017]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 89 pathogenic variants in the truncated region.
• PP5: Variant 3-181712418-G-GGCGGCGGCGGCAACTCCACC is Pathogenic according to our data. Variant chr3-181712418-G-GGCGGCGGCGGCAACTCCACC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 1992360.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003106.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SOX2	NM_003106.4	MANE Select	c.70_89dupAACTCCACCGCGGCGGCGGC	p.Gly31ThrfsTer22	frameshift	Exon 1 of 1	NP_003097.1
	SOX2-OT	NR_004053.3		n.768-2755_768-2736dupAACTCCACCGCGGCGGCGGC		intron	N/A
	SOX2-OT	NR_075089.1		n.767+12547_767+12566dupAACTCCACCGCGGCGGCGGC		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SOX2	ENST00000325404.3	TSL:6 MANE Select	c.70_89dupAACTCCACCGCGGCGGCGGC	p.Gly31ThrfsTer22	frameshift	Exon 1 of 1	ENSP00000323588.1
	SOX2-OT	ENST00000466034.7	TSL:1	n.349+12547_349+12566dupAACTCCACCGCGGCGGCGGC		intron	N/A
	SOX2-OT	ENST00000476964.6	TSL:1	n.482-27139_482-27120dupAACTCCACCGCGGCGGCGGC		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Anophthalmia/microphthalmia-esophageal atresia syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs398123693; hg19: chr3-181430206;