3-37007025-C-T

Variant names:

• chr3-37007025-C-T
• rs779562531
• NM_000249.4:c.415C>T

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM2 PM5

The NM_000249.4(MLH1):​c.415C>T​(p.Pro139Ser) variant causes a missense change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,750 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Another variant affecting the same amino acid position, but resulting in a different missense (i.e. P139A) has been classified as Uncertain significance.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: MLH1 NM_000249.4 missense
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 7.65
• Publications: 4 publications found

Genes affected

MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]

MLH1 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• Lynch syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
• Muir-Torre syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• Lynch syndrome 1

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• ovarian cancer

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• prostate cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 5 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 46 uncertain in NM_000249.4
• PM2: Very rare variant in population databases, with high coverage
• PM5: Other missense variant is known to change same aminoacid residue: Variant chr3-37007025-CCTAAACCATGTGCTGGCAATCAAGGGACCCAGATCACGGTAAGAATGGTACATGGGAGAGTAAATTGTTGAAGCTTTGTTTGTATAAATATTGGAATAAAAAATAAAATTGCTTCTAAGTTTTCAGGGTAATAATAAAATGAATTTGCACTAGTTAATGGAGGTCCCAAGATATCCTCTAAGCAAGATAAATGACTATTGGCTTTTGTGGCATGGCAGCCTGCCACGTCCTTGTCTTTTTTAAGGGCTAGGAGATTCTTTATTGGGATGGCAAAAGTCAATGGCAGGGTAGTTGTCATTGAAAGAAGATTAAGCTTGACCCCAGAAGGCATGGGTTAGAGCCCAGCCTTGTCACTCAATGGTTGTATGTCCAGAGGCAAGTCACTTAACATCCCTTAACCCCAGTTTTCTCATCTGTCAAATGAAGCAAAGAATACTTGCCCTCTTGACTTAAAGGGTGTCTGATGAGACATATGACTGTATCATTAGCTGGGAGAAAGTCCATCGTGCTGCCTATGTATAGTGCCTCAAGTTGGTCTCTTTCCCTTCTATGATTACA-GCTTTCCCC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 1999726.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000249.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MLH1	NM_000249.4	MANE Select	c.415C>T	p.Pro139Ser	missense	Exon 5 of 19	NP_000240.1
	MLH1	NM_001354628.2		c.415C>T	p.Pro139Ser	missense	Exon 5 of 18	NP_001341557.1
	MLH1	NM_001354629.2		c.316C>T	p.Pro106Ser	missense	Exon 4 of 18	NP_001341558.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MLH1	ENST00000231790.8	TSL:1 MANE Select	c.415C>T	p.Pro139Ser	missense	Exon 5 of 19	ENSP00000231790.3
	MLH1	ENST00000456676.7	TSL:1	c.415C>T	p.Pro139Ser	missense	Exon 5 of 17	ENSP00000416687.3
	MLH1	ENST00000413740.2	TSL:1	c.415C>T	p.Pro139Ser	missense	Exon 5 of 15	ENSP00000416476.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251438 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461750 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 727186

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.0000224 AC: 1 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.00 AC: 0 AN: 39692

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53410

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111912

Other (OTH) AF: 0.00 AC: 0 AN: 60382

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
AlphaMissense	Benign	0.20
BayesDel_addAF	Pathogenic	0.22	D
BayesDel_noAF	Pathogenic	0.16
CADD	Pathogenic	27
DANN	Uncertain	1.0
DEOGEN2	Uncertain	0.78	D
Eigen	Pathogenic	0.72
Eigen_PC	Pathogenic	0.77
FATHMM_MKL	Pathogenic	0.99	D
LIST_S2	Uncertain	0.96	D
M_CAP	Benign	0.073	D
MetaRNN	Uncertain	0.69	D
MetaSVM	Uncertain	0.59	D
MutationAssessor	Uncertain	2.0	M
PhyloP100		7.7
PrimateAI	Uncertain	0.64	T
PROVEAN	Pathogenic	-5.4	D
REVEL	Uncertain	0.63
Sift	Benign	0.043	D
Sift4G	Uncertain	0.043	D
Polyphen		0.92	P
Vest4		0.66
MutPred		0.26		Loss of catalytic residue at P138 (P = 0.0165)
MVP		0.90
MPC		0.19
ClinPred		0.89	D
GERP RS		6.2
RBP_binding_hub_radar		0.92
RBP_regulation_power_radar		2.6
Varity_R		0.59
gMVP		0.74
Mutation Taster		=22/78	disease causing

Splicing

Name	Calibrated prediction	Score	Prediction
SpliceAI score (max)		0.0		Details are displayed if max score is > 0.2

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs779562531; hg19: chr3-37048516;