3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A

Position:

• chr3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_004656.4(BAP1):​c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: BAP1 NM_004656.4 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.73

Genes affected

BAP1 (HGNC:950): (BRCA1 associated protein 1) This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]

BAP1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A is Benign according to our data. Variant chr3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A is described in ClinVar as [Likely_benign]. Clinvar id is 490878.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BAP1	NM_004656.4	c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		intron_variant		ENST00000460680.6	NP_004647.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BAP1	ENST00000460680.6	c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		intron_variant		1	NM_004656.4	ENSP00000417132.1
BAP1	ENST00000296288.9	c.660-95_660-66delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		intron_variant		5		ENSP00000296288.5
BAP1	ENST00000471532.5	n.786_815delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		non_coding_transcript_exon_variant	4/5	5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

Asia WGS AF: 0.000577 AC: 2 AN: 3478

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Color Diagnostics, LLC DBA Color Health

Oct 05, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553645628; hg19: chr3-52440403;