3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A

Variant names:

• chr3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A
• rs1553645628
• NM_004656.4:c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_004656.4(BAP1):​c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: BAP1 NM_004656.4 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.73
• Publications: 0 publications found

Genes affected

BAP1 (HGNC:950): (BRCA1 associated protein 1) This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]

BAP1 Gene-Disease associations (from GenCC):

• BAP1-related tumor predisposition syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Ambry Genetics, G2P, Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• Kury-Isidor syndrome

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, G2P
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A is Benign according to our data. Variant chr3-52406387-AGCCGCAGCCGTGAGAGCAGCTCCCGCCCCG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 490878.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BAP1	NM_004656.4	c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		intron_variant	Intron 8 of 16	ENST00000460680.6	NP_004647.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BAP1	ENST00000460680.6	c.660-41_660-12delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		intron_variant	Intron 8 of 16	1	NM_004656.4	ENSP00000417132.1
BAP1	ENST00000471532.5	n.786_815delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		non_coding_transcript_exon_variant	Exon 4 of 5	5
BAP1	ENST00000296288.9	c.660-95_660-66delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		intron_variant	Intron 8 of 16	5		ENSP00000296288.5
BAP1	ENST00000483984.5	n.*229_*258delCGGGGCGGGAGCTGCTCTCACGGCTGCGGC		downstream_gene_variant		3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

Asia WGS AF: 0.000577 AC: 2 AN: 3478

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Benign:1

Oct 05, 2017

Color Diagnostics, LLC DBA Color Health

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553645628; hg19: chr3-52440403;