3-78600169-CTGCAATATTTCTTCGACCTACATT-C

Variant names:

• chr3-78600169-CTGCAATATTTCTTCGACCTACATT-C
• NM_002941.4:c.4861_4884delAATGTAGGTCGAAGAAATATTGCA

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_002941.4(ROBO1):​c.4861_4884delAATGTAGGTCGAAGAAATATTGCA​(p.Asn1621_Ala1628del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ROBO1 NM_002941.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.91

Genes affected

ROBO1 (HGNC:10249): (roundabout guidance receptor 1) Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_002941.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ROBO1	NM_002941.4	c.4861_4884delAATGTAGGTCGAAGAAATATTGCA	p.Asn1621_Ala1628del	conservative_inframe_deletion	Exon 30 of 31	ENST00000464233.6	NP_002932.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ROBO1	ENST00000464233.6	c.4861_4884delAATGTAGGTCGAAGAAATATTGCA	p.Asn1621_Ala1628del	conservative_inframe_deletion	Exon 30 of 31	5	NM_002941.4	ENSP00000420321.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Apr 15, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed at significant frequency in large population cohorts (gnomAD); In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-78649319;