4-122612808-GTAAAGATAAAGCAGAAAATCAAATGAAACTTAAGGTAGATAC-G

Variant names:

• chr4-122612808-GTAAAGATAAAGCAGAAAATCAAATGAAACTTAAGGTAGATAC-G
• ENST00000611104.2:c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_021803.4(IL21):​c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IL21 NM_021803.4 splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.74
• Publications: 0 publications found

Genes affected

IL21 (HGNC:6005): (interleukin 21) This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

IL21 Gene-Disease associations (from GenCC):

• IL21-related infantile inflammatory bowel disease

  Inheritance: AR, Unknown Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• common variable immunodeficiency

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1595092 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IL21	NM_021803.4	c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		splice_donor_variant, splice_region_variant, intron_variant	Intron 4 of 4	ENST00000648588.1	NP_068575.1
IL21	NM_001207006.3	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA	p.Val147_Ter154del	stop_lost, conservative_inframe_deletion	Exon 4 of 4		NP_001193935.1
IL21	NM_001207006.3	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		3_prime_UTR_variant	Exon 4 of 4		NP_001193935.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IL21	ENST00000611104.2	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA	p.Val147_Ter154del	stop_lost, conservative_inframe_deletion	Exon 4 of 4	1		ENSP00000477555.1
IL21	ENST00000611104.2	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		3_prime_UTR_variant	Exon 4 of 4	1		ENSP00000477555.1
IL21	ENST00000648588.1	c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		splice_donor_variant, splice_region_variant, intron_variant	Intron 4 of 4		NM_021803.4	ENSP00000497915.1
IL21	ENST00000647784.1	n.290+1_290+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		splice_donor_variant, splice_region_variant, intron_variant	Intron 3 of 3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Feb 24, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects a splice site in intron 4 of the IL21 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in IL21 cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with IL21-related conditions. ClinVar contains an entry for this variant (Variation ID: 1515796). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr4-123533963;