4-122612808-GTAAAGATAAAGCAGAAAATCAAATGAAACTTAAGGTAGATAC-G

Position:

• chr4-122612808-GTAAAGATAAAGCAGAAAATCAAATGAAACTTAAGGTAGATAC-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001207006.3(IL21):​c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA​(p.Val147_Ter154del) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IL21 NM_001207006.3 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.74

Genes affected

IL21 (HGNC:6005): (interleukin 21) This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

IL21 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Stoplost variant in NM_001207006.3

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
IL21	NM_021803.4	c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		splice_donor_variant, splice_region_variant, intron_variant		ENST00000648588.1	NP_068575.1
IL21	NM_001207006.3	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA	p.Val147_Ter154del	stop_lost, conservative_inframe_deletion	4/4		NP_001193935.1
IL21	NM_001207006.3	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		3_prime_UTR_variant	4/4		NP_001193935.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
IL21	ENST00000611104.2	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA	p.Val147_Ter154del	stop_lost, conservative_inframe_deletion	4/4	1		ENSP00000477555.1
IL21	ENST00000611104.2	c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		3_prime_UTR_variant	4/4	1		ENSP00000477555.1
IL21	ENST00000648588.1	c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		splice_donor_variant, splice_region_variant, intron_variant			NM_021803.4	ENSP00000497915.1
IL21	ENST00000647784.1	n.290+1_290+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA		splice_donor_variant, splice_region_variant, intron_variant

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 20, 2020

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with IL21-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change affects a donor splice site in intron 4 of the IL21 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in IL21 cause disease. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-123533963;