4-122612808-GTAAAGATAAAGCAGAAAATCAAATGAAACTTAAGGTAGATAC-G
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001207006.3(IL21):c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA(p.Val147_Ter154del) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
IL21
NM_001207006.3 stop_lost, conservative_inframe_deletion
NM_001207006.3 stop_lost, conservative_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 1.74
Genes affected
IL21 (HGNC:6005): (interleukin 21) This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Stoplost variant in NM_001207006.3
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
IL21 | NM_021803.4 | c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | splice_donor_variant, splice_region_variant, intron_variant | ENST00000648588.1 | NP_068575.1 | |||
IL21 | NM_001207006.3 | c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | p.Val147_Ter154del | stop_lost, conservative_inframe_deletion | 4/4 | NP_001193935.1 | ||
IL21 | NM_001207006.3 | c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | 3_prime_UTR_variant | 4/4 | NP_001193935.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
IL21 | ENST00000611104.2 | c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | p.Val147_Ter154del | stop_lost, conservative_inframe_deletion | 4/4 | 1 | ENSP00000477555.1 | |||
IL21 | ENST00000611104.2 | c.439_*18delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | 3_prime_UTR_variant | 4/4 | 1 | ENSP00000477555.1 | ||||
IL21 | ENST00000648588.1 | c.438+1_438+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | splice_donor_variant, splice_region_variant, intron_variant | NM_021803.4 | ENSP00000497915.1 | |||||
IL21 | ENST00000647784.1 | n.290+1_290+42delGTATCTACCTTAAGTTTCATTTGATTTTCTGCTTTATCTTTA | splice_donor_variant, splice_region_variant, intron_variant |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Nov 20, 2020 | In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with IL21-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change affects a donor splice site in intron 4 of the IL21 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in IL21 cause disease. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.