4-139889909-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-T

Variant names:

• chr4-139889909-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• rs58015886
• NM_018717.5:c.1479_1526delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_018717.5(MAML3):​c.1479_1526delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln494_Gln509del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000007 in 1,428,744 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
• Consequence: MAML3 NM_018717.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.00
• Publications: 0 publications found

Genes affected

MAML3 (HGNC:16272): (mastermind like transcriptional coactivator 3) Enables transcription coactivator activity. Involved in Notch signaling pathway and positive regulation of transcription by RNA polymerase II. Located in nuclear speck. [provided by Alliance of Genome Resources, Apr 2022]

ENSG00000294637 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_018717.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018717.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAML3	NM_018717.5	MANE Select	c.1479_1526delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln509del	disruptive_inframe_deletion	Exon 2 of 5	NP_061187.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAML3	ENST00000509479.6	TSL:1 MANE Select	c.1479_1526delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln509del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000421180.1	Q96JK9
	MAML3	ENST00000899537.1		c.1479_1526delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln509del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000569596.1
	MAML3	ENST00000502696.1	TSL:2	c.109-159290_109-159243delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		intron	N/A	ENSP00000422783.1	H0Y920

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 7.00e-7 AC: 1 AN: 1428744 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 707956

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32738

American (AMR) AF: 0.0000227 AC: 1 AN: 44096

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25486

East Asian (EAS) AF: 0.00 AC: 0 AN: 38820

South Asian (SAS) AF: 0.00 AC: 0 AN: 85316

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52410

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5590

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1085330

Other (OTH) AF: 0.00 AC: 0 AN: 58958

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs58015886; hg19: chr4-140811063;