4-139889909-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGC
Variant summary
Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP3BS1BS2
The NM_018717.5(MAML3):c.1506_1526delGCAGCAGCAGCAGCAGCAGCA(p.Gln503_Gln509del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00124 in 1,476,644 control chromosomes in the GnomAD database, including 13 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_018717.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018717.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MAML3 | TSL:1 MANE Select | c.1506_1526delGCAGCAGCAGCAGCAGCAGCA | p.Gln503_Gln509del | disruptive_inframe_deletion | Exon 2 of 5 | ENSP00000421180.1 | Q96JK9 | ||
| MAML3 | c.1506_1526delGCAGCAGCAGCAGCAGCAGCA | p.Gln503_Gln509del | disruptive_inframe_deletion | Exon 2 of 5 | ENSP00000569596.1 | ||||
| MAML3 | TSL:2 | c.109-159263_109-159243delGCAGCAGCAGCAGCAGCAGCA | intron | N/A | ENSP00000422783.1 | H0Y920 |
Frequencies
GnomAD3 genomes AF: 0.0154 AC: 734AN: 47816Hom.: 9 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.000764 AC: 1091AN: 1428740Hom.: 4 AF XY: 0.000774 AC XY: 548AN XY: 707954 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0153 AC: 734AN: 47904Hom.: 9 Cov.: 0 AF XY: 0.0146 AC XY: 344AN XY: 23534 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.