4-139889909-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chr4-139889909-TTGCTGCTGCTGCTGCTGCTGC-T
• rs58015886
• NM_018717.5:c.1506_1526delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP3 BS1 BS2

The NM_018717.5(MAML3):​c.1506_1526delGCAGCAGCAGCAGCAGCAGCA​(p.Gln503_Gln509del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00124 in 1,476,644 control chromosomes in the GnomAD database, including 13 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.015 (9 hom., cov: 0)
  • Exomes 𝑓: 0.00076 (4 hom.)
• Consequence: MAML3 NM_018717.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.00
• Publications: 3 publications found

Genes affected

MAML3 (HGNC:16272): (mastermind like transcriptional coactivator 3) Enables transcription coactivator activity. Involved in Notch signaling pathway and positive regulation of transcription by RNA polymerase II. Located in nuclear speck. [provided by Alliance of Genome Resources, Apr 2022]

ENSG00000294637 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_018717.5
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.0153 (734/47904) while in subpopulation AFR AF = 0.024 (685/28494). AF 95% confidence interval is 0.0225. There are 9 homozygotes in GnomAd4. There are 344 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 734 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018717.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAML3	NM_018717.5	MANE Select	c.1506_1526delGCAGCAGCAGCAGCAGCAGCA	p.Gln503_Gln509del	disruptive_inframe_deletion	Exon 2 of 5	NP_061187.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAML3	ENST00000509479.6	TSL:1 MANE Select	c.1506_1526delGCAGCAGCAGCAGCAGCAGCA	p.Gln503_Gln509del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000421180.1	Q96JK9
	MAML3	ENST00000899537.1		c.1506_1526delGCAGCAGCAGCAGCAGCAGCA	p.Gln503_Gln509del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000569596.1
	MAML3	ENST00000502696.1	TSL:2	c.109-159263_109-159243delGCAGCAGCAGCAGCAGCAGCA		intron	N/A	ENSP00000422783.1	H0Y920

Frequencies

GnomAD3 genomes AF: 0.0154 AC: 734 AN: 47816 Hom.: 9 Cov.: 0

Gnomad AFR AF: 0.0241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00243

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00389

Gnomad SAS AF: 0.00390

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00191

Gnomad OTH AF: 0.0140

GnomAD4 exome AF: 0.000764 AC: 1091 AN: 1428740 Hom.: 4 AF XY: 0.000774 AC XY: 548 AN XY: 707954

African (AFR) AF: 0.0150 AC: 492 AN: 32736

American (AMR) AF: 0.000658 AC: 29 AN: 44096

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25486

East Asian (EAS) AF: 0.00379 AC: 147 AN: 38820

South Asian (SAS) AF: 0.00253 AC: 216 AN: 85316

European-Finnish (FIN) AF: 0.0000191 AC: 1 AN: 52410

Middle Eastern (MID) AF: 0.000358 AC: 2 AN: 5590

European-Non Finnish (NFE) AF: 0.000143 AC: 155 AN: 1085328

Other (OTH) AF: 0.000831 AC: 49 AN: 58958

GnomAD4 genome AF: 0.0153 AC: 734 AN: 47904 Hom.: 9 Cov.: 0 AF XY: 0.0146 AC XY: 344 AN XY: 23534

African (AFR) AF: 0.0240 AC: 685 AN: 28494

American (AMR) AF: 0.00243 AC: 13 AN: 5358

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 670

East Asian (EAS) AF: 0.00390 AC: 9 AN: 2310

South Asian (SAS) AF: 0.00312 AC: 4 AN: 1284

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 1668

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 86

European-Non Finnish (NFE) AF: 0.00191 AC: 14 AN: 7334

Other (OTH) AF: 0.0139 AC: 9 AN: 648

Alfa AF: 0.00 Hom.: 1

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0
Mutation Taster		=177/23	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs58015886;

hg19: chr4-140811063;