4-139889909-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chr4-139889909-T-TTGCTGC
• rs58015886
• NM_018717.5:c.1521_1526dupGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_018717.5(MAML3):​c.1521_1526dupGCAGCA​(p.Gln508_Gln509dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0039 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0012 (36 hom.)
  • Failed GnomAD Quality Control
• Consequence: MAML3 NM_018717.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.616

Genes affected

MAML3 (HGNC:16272): (mastermind like transcriptional coactivator 3) Enables transcription coactivator activity. Involved in Notch signaling pathway and positive regulation of transcription by RNA polymerase II. Located in nuclear speck. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 186 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MAML3	NM_018717.5	c.1521_1526dupGCAGCA	p.Gln508_Gln509dup	disruptive_inframe_insertion	Exon 2 of 5	ENST00000509479.6	NP_061187.3
MAML3	XM_047415929.1	c.1521_1526dupGCAGCA	p.Gln508_Gln509dup	disruptive_inframe_insertion	Exon 2 of 5		XP_047271885.1
MAML3	XM_047415930.1	c.1521_1526dupGCAGCA	p.Gln508_Gln509dup	disruptive_inframe_insertion	Exon 2 of 3		XP_047271886.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MAML3	ENST00000509479.6	c.1521_1526dupGCAGCA	p.Gln508_Gln509dup	disruptive_inframe_insertion	Exon 2 of 5	1	NM_018717.5	ENSP00000421180.1
MAML3	ENST00000502696.1	c.109-159248_109-159243dupGCAGCA		intron_variant	Intron 1 of 3	2		ENSP00000422783.1

Frequencies

GnomAD3 genomes AF: 0.00385 AC: 184 AN: 47818 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00151

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00206

Gnomad ASJ AF: 0.0328

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000780

Gnomad FIN AF: 0.00120

Gnomad MID AF: 0.0104

Gnomad NFE AF: 0.0135

Gnomad OTH AF: 0.00776

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00125 AC: 1782 AN: 1428132 Hom.: 36 Cov.: 0 AF XY: 0.00118 AC XY: 833 AN XY: 707644

Gnomad4 AFR exome AF: 0.00101

Gnomad4 AMR exome AF: 0.000544

Gnomad4 ASJ exome AF: 0.00483

Gnomad4 EAS exome AF: 0.0000515

Gnomad4 SAS exome AF: 0.000281

Gnomad4 FIN exome AF: 0.000382

Gnomad4 NFE exome AF: 0.00137

Gnomad4 OTH exome AF: 0.00112

GnomAD4 genome AF: 0.00388 AC: 186 AN: 47906 Hom.: 0 Cov.: 0 AF XY: 0.00353 AC XY: 83 AN XY: 23534

Gnomad4 AFR AF: 0.00158

Gnomad4 AMR AF: 0.00205

Gnomad4 ASJ AF: 0.0328

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000779

Gnomad4 FIN AF: 0.00120

Gnomad4 NFE AF: 0.0135

Gnomad4 OTH AF: 0.00772

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs58015886; hg19: chr4-140811063;