4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs71180116
• NM_001388492.1:c.81_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001388492.1(HTT):​c.81_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln28_Gln37del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000091 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0013 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.65
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HTT	NM_001388492.1	c.81_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln28_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	ENST00000355072.11	NP_001375421.1
HTT	NM_002111.8	c.81_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln28_Gln37del	disruptive_inframe_deletion	Exon 1 of 67		NP_002102.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HTT	ENST00000355072.11	c.81_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln28_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	1	NM_001388492.1	ENSP00000347184.5

Frequencies

GnomAD3 genomes AF: 0.0000911 AC: 12 AN: 131784 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000282

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000746

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000130

Gnomad OTH AF: 0.00111

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00132 AC: 1618 AN: 1225682 Hom.: 2 AF XY: 0.00128 AC XY: 776 AN XY: 608060

African (AFR) AF: 0.000387 AC: 10 AN: 25814

American (AMR) AF: 0.000330 AC: 10 AN: 30298

Ashkenazi Jewish (ASJ) AF: 0.000836 AC: 19 AN: 22734

East Asian (EAS) AF: 0.000137 AC: 4 AN: 29096

South Asian (SAS) AF: 0.000706 AC: 51 AN: 72234

European-Finnish (FIN) AF: 0.000369 AC: 12 AN: 32500

Middle Eastern (MID) AF: 0.000529 AC: 2 AN: 3784

European-Non Finnish (NFE) AF: 0.00153 AC: 1468 AN: 957390

Other (OTH) AF: 0.000810 AC: 42 AN: 51832

GnomAD4 genome AF: 0.0000910 AC: 12 AN: 131882 Hom.: 0 Cov.: 0 AF XY: 0.000110 AC XY: 7 AN XY: 63426

African (AFR) AF: 0.0000281 AC: 1 AN: 35524

American (AMR) AF: 0.0000746 AC: 1 AN: 13412

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3190

East Asian (EAS) AF: 0.00 AC: 0 AN: 4124

South Asian (SAS) AF: 0.00 AC: 0 AN: 3910

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 252

European-Non Finnish (NFE) AF: 0.000130 AC: 8 AN: 61486

Other (OTH) AF: 0.00110 AC: 2 AN: 1816

Alfa AF: 0.00 Hom.: 452

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=122/78	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;