4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs71180116
• NM_001388492.1:c.84_110delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS1

The ENST00000355072.11(HTT):​c.84_110delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln29_Gln37del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00026 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0021 (19 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT ENST00000355072.11 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.65
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000355072.11
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000258 (34/131882) while in subpopulation SAS AF = 0.000767 (3/3910). AF 95% confidence interval is 0.000209. There are 0 homozygotes in GnomAd4. There are 16 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000355072.11. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	NM_001388492.1	MANE Select	c.84_110delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln29_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	NP_001375421.1
	HTT	NM_002111.8		c.84_110delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln29_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	NP_002102.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	ENST00000355072.11	TSL:1 MANE Select	c.84_110delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln29_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	ENSP00000347184.5
	HTT	ENST00000680291.1		n.229_255delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 1 of 41
	HTT	ENST00000681528.1		c.6-12030_6-12004delGCAGCAGCAGCAGCAGCAGCAGCAGCA		intron	N/A	ENSP00000506116.1

Frequencies

GnomAD3 genomes AF: 0.000258 AC: 34 AN: 131784 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000169

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000149

Gnomad ASJ AF: 0.000627

Gnomad EAS AF: 0.000725

Gnomad SAS AF: 0.000767

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00373

Gnomad NFE AF: 0.000228

Gnomad OTH AF: 0.00167

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00213 AC: 2605 AN: 1225660 Hom.: 19 AF XY: 0.00214 AC XY: 1302 AN XY: 608074

African (AFR) AF: 0.000891 AC: 23 AN: 25812

American (AMR) AF: 0.000594 AC: 18 AN: 30300

Ashkenazi Jewish (ASJ) AF: 0.00383 AC: 87 AN: 22724

East Asian (EAS) AF: 0.000137 AC: 4 AN: 29096

South Asian (SAS) AF: 0.00253 AC: 183 AN: 72224

European-Finnish (FIN) AF: 0.0000615 AC: 2 AN: 32500

Middle Eastern (MID) AF: 0.00238 AC: 9 AN: 3780

European-Non Finnish (NFE) AF: 0.00226 AC: 2164 AN: 957388

Other (OTH) AF: 0.00222 AC: 115 AN: 51836

GnomAD4 genome AF: 0.000258 AC: 34 AN: 131882 Hom.: 0 Cov.: 0 AF XY: 0.000252 AC XY: 16 AN XY: 63424

African (AFR) AF: 0.000169 AC: 6 AN: 35524

American (AMR) AF: 0.000149 AC: 2 AN: 13410

Ashkenazi Jewish (ASJ) AF: 0.000627 AC: 2 AN: 3190

East Asian (EAS) AF: 0.000727 AC: 3 AN: 4124

South Asian (SAS) AF: 0.000767 AC: 3 AN: 3910

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7368

Middle Eastern (MID) AF: 0.00397 AC: 1 AN: 252

European-Non Finnish (NFE) AF: 0.000228 AC: 14 AN: 61488

Other (OTH) AF: 0.00165 AC: 3 AN: 1816

Alfa AF: 0.00 Hom.: 452

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=113/87	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;