4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs71180116
• NM_001388492.1:c.87_110delGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS1

The ENST00000355072.11(HTT):​c.87_110delGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln30_Gln37del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000315 in 1,357,636 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00020 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00033 (0 hom.)
• Consequence: HTT ENST00000355072.11 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.65
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000355072.11
• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.000205 (27/131784) while in subpopulation AMR AF = 0.000299 (4/13398). AF 95% confidence interval is 0.000125. There are 0 homozygotes in GnomAd4. There are 13 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000355072.11. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	NM_001388492.1	MANE Select	c.87_110delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln30_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	NP_001375421.1
	HTT	NM_002111.8		c.87_110delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln30_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	NP_002102.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	ENST00000355072.11	TSL:1 MANE Select	c.87_110delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln30_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	ENSP00000347184.5
	HTT	ENST00000680291.1		n.232_255delGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 1 of 41
	HTT	ENST00000681528.1		c.6-12027_6-12004delGCAGCAGCAGCAGCAGCAGCAGCA		intron	N/A	ENSP00000506116.1

Frequencies

GnomAD3 genomes AF: 0.000205 AC: 27 AN: 131784 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000198

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000299

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000242

Gnomad SAS AF: 0.000256

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00373

Gnomad NFE AF: 0.000211

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000326 AC: 400 AN: 1225852 Hom.: 0 AF XY: 0.000350 AC XY: 213 AN XY: 608144

African (AFR) AF: 0.00136 AC: 35 AN: 25814

American (AMR) AF: 0.000396 AC: 12 AN: 30304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22736

East Asian (EAS) AF: 0.00124 AC: 36 AN: 29096

South Asian (SAS) AF: 0.000360 AC: 26 AN: 72228

European-Finnish (FIN) AF: 0.0000615 AC: 2 AN: 32498

Middle Eastern (MID) AF: 0.00132 AC: 5 AN: 3782

European-Non Finnish (NFE) AF: 0.000265 AC: 254 AN: 957558

Other (OTH) AF: 0.000579 AC: 30 AN: 51836

GnomAD4 genome AF: 0.000205 AC: 27 AN: 131784 Hom.: 0 Cov.: 0 AF XY: 0.000205 AC XY: 13 AN XY: 63316

African (AFR) AF: 0.000198 AC: 7 AN: 35416

American (AMR) AF: 0.000299 AC: 4 AN: 13398

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3190

East Asian (EAS) AF: 0.000242 AC: 1 AN: 4136

South Asian (SAS) AF: 0.000256 AC: 1 AN: 3912

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7368

Middle Eastern (MID) AF: 0.00373 AC: 1 AN: 268

European-Non Finnish (NFE) AF: 0.000211 AC: 13 AN: 61500

Other (OTH) AF: 0.00 AC: 0 AN: 1796

Alfa AF: 0.00 Hom.: 452

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=110/90	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;