4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_StrongBS1BS2
The NM_001388492.1(HTT):c.99_110dupGCAGCAGCAGCA(p.Gln34_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).
Frequency
Consequence
NM_001388492.1 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Huntington diseaseInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen
- Lopes-Maciel-Rodan syndromeInheritance: AR Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- juvenile Huntington diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001388492.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | MANE Select | c.99_110dupGCAGCAGCAGCA | p.Gln34_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | NP_001375421.1 | P42858 | ||
| HTT | c.99_110dupGCAGCAGCAGCA | p.Gln34_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | NP_002102.4 | P42858 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | TSL:1 MANE Select | c.99_110dupGCAGCAGCAGCA | p.Gln34_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | ENSP00000347184.5 | P42858 | ||
| HTT | c.6-12015_6-12004dupGCAGCAGCAGCA | intron | N/A | ENSP00000506116.1 | A0A7P0TAC5 | ||||
| HTT | c.6-12015_6-12004dupGCAGCAGCAGCA | intron | N/A | ENSP00000506029.1 | A0A7P0TA78 |
Frequencies
GnomAD3 genomes AF: 0.0265 AC: 3497AN: 131756Hom.: 75 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0103 AC: 12565AN: 1225544Hom.: 164 Cov.: 0 AF XY: 0.0111 AC XY: 6749AN XY: 608000 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0266 AC: 3503AN: 131854Hom.: 75 Cov.: 0 AF XY: 0.0264 AC XY: 1672AN XY: 63404 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at